Acleris umbrana

(Hübner, 1796-1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records1 751

Data sources9

Biological traits2

DNA specimens16

eDNA detections16

Sources9 archives

Databases and archives Acleris umbrana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 751 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 751 records

Environmental DNA1 datasets · 5 countries16 detections

DNA & barcodingBOLD16 specimens

Genome at a glanceGoaT · NCBI≈605 Mbp

01Narrative

Acleris umbrana is a species of moth of the family Tortricidae. It is found in Great Britain, France, Belgium, Germany, Austria, Switzerland, Italy, the Czech Republic, Slovakia, Poland, Hungary, Norway, Sweden, Finland, the Baltic region and Russia.Fauna Europaea In the east, the range extends to Japan. The habitat consists of woodland, fens and marshes.Hants Moths The wingspan is 18–23 mm. Adults are on wing in one generation from July and August to late October and, after overwintering, from late February to early May.Lepidoptera of Belgium The larvae feed on Sorbus aucuparia, Alnus glutinosa, Cornus sanguinea, Salix caprea, Prunus spinosa, Prunus avium, Crataegus and Carpinus species. They feed within spun leaves of their host plant. Larvae can be found in June and July. The species overwinters as an adult.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris umbrana has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections16

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris maximanasame genus4.3%Acleris roscidanasame genus4.6%Acleris cristanasame genus4.7%Acleris cervinanasame genus4.7%Acleris maculidorsanasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acleris umbrana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈605 000 663 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris umbrana0.61 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.2% BUSCO

08Occurrence & distribution

Record type1 751 records

Wild obs. + sensor1 563

Museum / vouchered179

Other9

Range

Area of Occupancy AOO3 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 777≤1 km 386≤10 km 280>10 km 14

1 457 georeferenced · 106 without coordinates

Open the mapobservation + sensor1 563

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 80≤1 km 77≤10 km 7

164 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	48
Tartu, EE	36
Kuopio, FI	17
DanishLepidopterologicalSocietylocation not on record	6
Provincia di Livornolocation not on record	4
Rovaniemi, FI	2
KIRMlocation not on record	2
SLU Artdatabankenlocation not on record	2
Salzburg, AT	1
DABUHlocation not on record	1
South Kensington, GB	1

11 institutions · 120 of 179 vouchered records shown · 59 without an institution code

09Environmental DNA16 detections

Where the DNA of Acleris umbrana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.50 °C 3.30–15.3

Seasonal swing summer↔winter20.6 °C

Max temp (day)9.30 °C 6.60–18.8

Min temp (night)1.70 °C -2.50–11.3

Precipitation82.3 mm/mo 48.2–127

Air humidity60.7 % 58.3–66.3

Moisture balance10.5 mm/mo -10.8–37.5

Vapour deficit372 Pa 282–658

Wind speed2.70 m/s 1.30–4.30

Cloud cover46.8 % 38.5–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris umbrana

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 751 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 751 records