Acleris logiana

(Clerck, 1759) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records4 214

Data sources10

Biological traits2

DNA specimens68

eDNA detections87

Sources10 archives

Databases and archives Acleris logiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI87 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 214 records

Environmental DNA3 datasets · 9 countries87 detections

DNA & barcodingBOLD68 specimens

Genome at a glanceGoaT · NCBI≈530 Mbp

01Narrative

Acleris logiana, the black-headed birch leaffolder moth or grey birch button, is a moth of the family Tortricidae. It was described by Carl Alexander Clerck in 1759. It is found in most of Europe, except Ireland, Portugal, most of the Balkan Peninsula and Ukraine.Fauna Europaea It is also found in North America,mothphotographersgroup the Russian Far East, Korea and Japan.Seven species of Tortricinae (Lepidoptera; Tortricidae) new to Korea The wingspan is 18–22 mm.microlepidoptera.nl The forewings are whitish or pale grey, dotted with tufts of raised dusky scales.Bug Guide Adults are on wing from September to April after overwintering. The larvae feed on Betula species. They feed between the spun leaves of their host plant.UKmoths

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris logiana has left across the world's sequence archives.

At a glance

DNA specimens68

BINs2

Marker genes1

eDNA detections87

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus60 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

28Amostly conserved

31Avariable

50Tvariable

59Tvariable

124Tvariable

142Tvariable

145Cvariable

160Amostly conserved

235Cvariable

250Tvariable

271Tvariable

364Cvariable

370Tvariable

376Cvariable

382Tmostly conserved

391Cvariable

418Tvariable

445Cvariable

499Tvariable

568Avariable

616Cvariable

634Cvariable

646Tvariable

AACATTATACTTCATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes9

BINs2

Most divergent pair3.2%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris boscanoidessame genus3.2%Acleris kochiellasame genus3.3%Acleris caliginosanasame genus4.9%Acleris bowmananasame genus4.9%Acleris roscidanasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acleris logiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈530 365 732 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris logiana0.53 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.5% BUSCO

08Occurrence & distribution

Record type4 214 records

Wild obs. + sensor3 447

Museum / vouchered699

Other68

Origin

Native1

Range

Area of Occupancy AOO7 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 985≤1 km 732≤10 km 1 517>10 km 17

3 251 georeferenced · 196 without coordinates

Open the mapobservation + sensor3 447

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 175≤1 km 198≤10 km 109>10 km 7

489 georeferenced · 210 without coordinates

Open the institutions mapphysical evidence699

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	158
Tartu, EE	87
NHMOlocation not on record	76
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	53
University of Alberta Museums (UAM)location not on record	44
Provincia di Livornolocation not on record	44
Kuopio, FI	28
SLU Artdatabankenlocation not on record	23
NTNU-VMlocation not on record	14
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
Royal Saskatchewan Museumlocation not on record	10
Salzburg, AT	8
Rovaniemi, FI	6
King Saud Universitylocation not on record	5
Philadelphia, US	5
ZSMlocation not on record	4
Stockholm, SE	4
DABUHlocation not on record	3
BioFokuslocation not on record	3
University of Kaiserslauternlocation not on record	2
Mississippi State, US	2
Tallinn, EE	2
Bavarian State Collection of Zoologylocation not on record	2
CBDClocation not on record	2
Nijmegen, NL	2
South Kensington, GB	2
KIRMlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
University of California, Davislocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Uniwersytet Łódzkilocation not on record	1
ZMAAlocation not on record	1
Washington, US	1
SOVTlocation not on record	1

37 institutions · 612 of 699 vouchered records shown · 87 without an institution code

09Environmental DNA87 detections

Where the DNA of Acleris logiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found87

Studies independent surveys3

Countries9

Verifiable raw sequence linked9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 87 detections have coordinates

Open the map9 countries0

Grassland1. Forest & Woodland|1.1. Boreal ForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 4.70–19.2

Seasonal swing summer↔winter25.5 °C

Max temp (day)15.7 °C 8.80–24.4

Min temp (night)6.10 °C 0.1–14.2

Precipitation86.9 mm/mo 54.5–145

Air humidity58.8 % 55.0–63.8

Moisture balance-0.9 mm/mo -48.4–61.4

Vapour deficit550 Pa 330–929

Wind speed3.10 m/s 2.10–4.00

Cloud cover46.5 % 38.8–55.6

CHELSA 1981–2010, ~9 km grid, at location & month of 82 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris logiana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 214 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 214 records