Acleris bowmanana

(McDunnough, 1934) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records175

Data sources7

Biological traits0

DNA specimens29

eDNA detections33

Sources7 archives

Databases and archives Acleris bowmanana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility175 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF175 records

Environmental DNA1 datasets · 2 countries33 detections

DNA & barcodingBOLD29 specimens

01Narrative

Acleris bowmanana is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, British Columbia, California, Maine, Manitoba, Maryland, Michigan, New Brunswick, Ontario, Quebec, West Virginia and Wisconsin.mothphotographersgroup The wingspan is about 22 mm for males and 18–20 mm for females. The forewings are uniform deep purple-grey with a slight admixture of burnt-sienna scaling and a small ruddy shade at the base of the wing. The hindwings are semihyaline whitish, but slightly smoky apically.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290-332 Adults have been recorded on wing from January to November. The larvae feed on Myrica gale, Picea engelmannii, Picea glauca, Aronia melanocarpa, Spiraea and Rubus species.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris bowmanana has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections33

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

85Gvariable

202Amostly conserved

302Amostly conserved

472Tmostly conserved

550Amostly conserved

604Tmostly conserved

628Amostly conserved

629Gmostly conserved

631Gmostly conserved

633Amostly conserved

634Cmostly conserved

637Amostly conserved

639Tmostly conserved

643Amostly conserved

644Tmostly conserved

645Amostly conserved

646Tmostly conserved

647Cmostly conserved

648Amostly conserved

650Cmostly conserved

651Amostly conserved

652Tmostly conserved

653Cmostly conserved

654Tmostly conserved

655Amostly conserved

656Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes5

BINs2

Most divergent pair8.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris lipsianasame genus4.4%Acleris roscidanasame genus4.7%Acleris inanasame genus4.9%Acleris logianasame genus4.9%Acleris britanniasame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type175 records

Wild obs. + sensor79

Museum / vouchered96

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 50≤1 km 4≤10 km 5>10 km 3

62 georeferenced · 17 without coordinates

Open the mapobservation + sensor79

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 4≤1 km 6≤10 km 8

18 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	27
University of Alberta Museums (UAM)location not on record	26
Cornell University Insect Collectionlocation not on record	12
East Lansing, US	6
New Haven, US	4
San Francisco, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Edmonton, CA	2
Research Collection of Daniel Handfieldlocation not on record	1

9 institutions · 85 of 96 vouchered records shown · 11 without an institution code

09Environmental DNA33 detections

Where the DNA of Acleris bowmanana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.60 °C -2.40–11.6

Seasonal swing summer↔winter29.4 °C

Max temp (day)7.80 °C 2.20–17.2

Min temp (night)0.8 °C -7.20–8.90

Precipitation79.6 mm/mo 57.2–117

Air humidity57.7 % 54.1–62.6

Moisture balance15.7 mm/mo -32.4–63.6

Vapour deficit316 Pa 221–591

Wind speed3.00 m/s 2.20–4.30

Cloud cover52.2 % 45.2–56.4

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)