Acleris lipsiana

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records3 032

Data sources9

Biological traits2

DNA specimens23

eDNA detections28

Sources9 archives

Databases and archives Acleris lipsiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 032 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 032 records

Environmental DNA2 datasets · 7 countries28 detections

DNA & barcodingBOLD23 specimens

Genome at a glanceGoaT · NCBI≈600 Mbp

01Narrative

Acleris lipsiana is a species of moth of the family Tortricidae. It is found in Great Britain, Spain, France, Belgium, the Netherlands, Germany, Denmark, Austria, Switzerland, Italy, the Czech Republic, Slovakia, Hungary, Poland, Greece, Norway, Sweden, Finland, the Baltic region and Russia.Fauna Europaea It is also found in North America, where it has been recorded from Alberta and Washington.mothphotographersgroup The habitat consists of high moors and mountainous areas.UKmoths The wingspan is 17–24 mm. Adults are on wing from August to October and, after hibernation, to April. The larvae feed on Vaccinium myrtillus, Vaccinium vitis-idaea, Myrica gale, Malus sylvestris, Betula and Pyrus species. They feed from within spun shoots or leaves of their host plant. Larvae can be found from June to July. Pupation takes places at the feeding place or on the ground.Lepidoptera of Belgium

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris lipsiana has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections28

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

85Avariable

106Cvariable

505Cvariable

550Avariable

619Gvariable

625Gvariable

640Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes4

BIN1

Most divergent pair1.2%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris rufanasame genus2.9%Acleris bowmananasame genus4.4%Acleris aenigmanasame genus4.6%Acleris chalybeanasame genus4.6%Acleris sparsanasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acleris lipsiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈600 167 612 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris lipsiana0.60 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.4% BUSCO

08Occurrence & distribution

Record type3 032 records

Wild obs. + sensor2 619

Museum / vouchered390

Other23

Range

Area of Occupancy AOO3 888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 446≤1 km 637≤10 km 477>10 km 3

2 563 georeferenced · 56 without coordinates

Open the mapobservation + sensor2 619

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 141≤1 km 164≤10 km 40>10 km 1

346 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence390

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	80
Tartu, EE	42
DanishLepidopterologicalSocietylocation not on record	41
Kuopio, FI	39
SLU Artdatabankenlocation not on record	29
Rovaniemi, FI	23
Provincia di Livornolocation not on record	13
Stockholm, SE	8
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	8
BioFokuslocation not on record	5
Metsähallituslocation not on record	3
DABUHlocation not on record	3
NMBU:MINAlocation not on record	2
NTNU-VMlocation not on record	2
ZMAAlocation not on record	2
Tallinn, EE	1
Philadelphia, US	1
CBDClocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
University of Kaiserslauternlocation not on record	1
ZSMlocation not on record	1
Salzburg, AT	1
neflocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

25 institutions · 310 of 390 vouchered records shown · 80 without an institution code

09Environmental DNA28 detections

Where the DNA of Acleris lipsiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys2

Countries7

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map7 countries0

Cranberry bushForestMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.70 °C 5.00–12.3

Seasonal swing summer↔winter19.5 °C

Max temp (day)11.6 °C 8.30–15.8

Min temp (night)4.20 °C 1.70–9.10

Precipitation80.4 mm/mo 51.6–242

Air humidity63.8 % 57.0–66.1

Moisture balance34.0 mm/mo -21.4–182

Vapour deficit398 Pa 355–560

Wind speed2.80 m/s 2.20–5.40

Cloud cover47.2 % 40.0–55.2

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris lipsiana

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 032 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 032 records