Acleris chalybeana

(Fernald, 1882) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records823

Data sources8

Biological traits0

DNA specimens142

eDNA detections149

Sources8 archives

Databases and archives Acleris chalybeana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility823 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI149 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics142 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF823 records

Environmental DNA1 datasets · 2 countries149 detections

DNA & barcodingBOLD142 specimens

01Narrative

Acleris chalybeana, the lesser maple leafroller moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Arkansas, Connecticut, Florida, Illinois, Indiana, Kentucky, Maine, Maryland, Mississippi, New Hampshire, New Jersey, New York, North Carolina, Ohio, Ontario, Pennsylvania, Quebec, South Carolina, Tennessee, West Virginia and Wisconsin.mothphotographersgroup The wingspan is 20–21 mm. The forewings are olive grey.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290–332 Adults have been recorded on wing from March to November. The larvae feed on the leaves of Acer rubrum, Acer saccharinum, Acer spicatum, Quercus rubra, Betula (including Betula papyrifera), Corylus and Fagus species.Tortricidae Food Plant Database They are light green and reach a length of about 19 mm. Early instar larvae may overwinter in hibernacula on twigs of their host plant. Pupation takes place in a folded leaf shelter.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding142 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris chalybeana has left across the world's sequence archives.

At a glance

DNA specimens142

BINs1

Marker genes1

eDNA detections149

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus136 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

268Amostly conserved

622Tmostly conserved

625Amostly conserved

628Amostly conserved

631Tmostly conserved

632Gmostly conserved

633Amostly conserved

634Tmostly conserved

643Amostly conserved

644Tmostly conserved

645Amostly conserved

646Tmostly conserved

647Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes9

BIN1

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris cervinanasame genus4.2%Acleris subnivanasame genus4.3%Acleris braunanasame genus4.3%Acleris ferrumixtanasame genus4.6%Acleris forsskaleanasame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type823 records

Wild obs. + sensor529

Museum / vouchered294

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 343≤1 km 58≤10 km 17>10 km 44

462 georeferenced · 67 without coordinates

Open the mapobservation + sensor529

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 8≤1 km 21≤10 km 26>10 km 1

56 georeferenced · 238 without coordinates

Open the institutions mapphysical evidence294

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	49
Biodiversity Institute of Ontariolocation not on record	42
St. Paul, US	39
New Haven, US	36
Cornell University Insect Collectionlocation not on record	31
East Lansing, US	14
Mississippi State, US	7
Decorah, US	2
San Francisco, US	2
CUlocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1
SOVTlocation not on record	1

12 institutions · 225 of 294 vouchered records shown · 69 without an institution code

09Environmental DNA149 detections

Where the DNA of Acleris chalybeana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found149

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 149 detections have coordinates

Open the map2 countries0

1. Forest & Woodlandhighbush blueberry cropsMixed habitat14. Artificial - Terrestrial|14.5 Urban AreasForest5. Wetlands (inland)|5.4. Bogs, Marshes, Swa…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 6.20–19.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)18.1 °C 10.2–24.2

Min temp (night)8.00 °C 1.20–15.4

Precipitation86.4 mm/mo 72.3–94.2

Air humidity55.5 % 54.7–59.8

Moisture balance-18.2 mm/mo -56.3–6.50

Vapour deficit655 Pa 416–911

Wind speed3.60 m/s 2.60–4.40

Cloud cover47.3 % 39.8–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 148 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)