Acleris britannia

Kearfott, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records60

Data sources8

Biological traits0

DNA specimens57

eDNA detections56

Sources8 archives

Databases and archives Acleris britannia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI56 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF60 records

Environmental DNA1 datasets · 2 countries56 detections

DNA & barcodingBOLD57 specimens

01Narrative

Acleris britannia, the Brittania moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, British Columbia, California, Oregon, Saskatchewan and Washington.mothphotographersgroup The forewings are pale orange yellow with a large purple-brown pale-centered costal triangle and slight dark sprinkling or reticulation (a net-like pattern).McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290-332 Adults have been recorded on wing from June to October. The larvae feed on Rubus occidentalis, Rubus parviflorus, Rubus ursinus, Potentilla and Rosa species.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris britannia has left across the world's sequence archives.

At a glance

DNA specimens57

BINs1

Marker genes1

eDNA detections56

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus54 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

217Gmostly conserved

271Avariable

292Cmostly conserved

AACATTATACTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes9

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris keiferisame genus3.3%Acleris varieganasame genus3.5%Acleris inanasame genus3.8%Acleris permutanasame genus4.4%Acleris fragarianasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type60 records

Wild obs. + sensor9

Museum / vouchered51

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 4

7 georeferenced · 2 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 1≤1 km 15≤10 km 1

17 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	9
KWPlocation not on record	7
University of Alberta Museums (UAM)location not on record	4
Washington, US	4
St. Paul, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Mississippi State, US	1
Centre for Biodiversity Genomicslocation not on record	1
Washington State Department of Agriculturelocation not on record	1
Essig Museum of Entomologylocation not on record	1

10 institutions · 35 of 51 vouchered records shown · 16 without an institution code

09Environmental DNA56 detections

Where the DNA of Acleris britannia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found56

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 56 detections have coordinates

Open the map2 countries0

5. Wetlands (inland)ForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 10.9–17.8

Seasonal swing summer↔winter10.1 °C

Max temp (day)20.5 °C 15.4–21.9

Min temp (night)11.8 °C 6.70–13.8

Precipitation80.2 mm/mo 42.2–109

Air humidity64.0 % 56.7–64.8

Moisture balance-21.6 mm/mo -85.2–54.4

Vapour deficit599 Pa 522–821

Wind speed3.90 m/s 1.10–4.50

Cloud cover35.2 % 30.1–50.7

CHELSA 1981–2010, ~9 km grid, at location & month of 53 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)