Acleris fragariana

Kearfott, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records82

Data sources8

Biological traits0

DNA specimens30

eDNA detections22

Sources8 archives

Databases and archives Acleris fragariana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility82 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF82 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD30 specimens

01Narrative

Acleris fragariana is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, California, Maine, Minnesota, New Hampshire, New York, Ontario and Washington.mothphotographersgroup The wingspan is 15–16 mm. The forewings are pale orange-yellow in the basal half and with reddish-purple suffusion over the outer area and along the inner margin to the base.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290-332 Adults have been recorded on wing from July to October. The larvae feed on Myrica gale, Aronia melanocarpa, Fragaria (including Fragaria virginiana), Prunus, Rosa, Rubus and Pouteria species.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris fragariana has left across the world's sequence archives.

At a glance

DNA specimens30

BINs2

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 93 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

13Tmostly conserved

14Amostly conserved

16Cvariable

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

21Gmostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

35Tmostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

46Tmostly conserved

48Cmostly conserved

49Tmostly conserved

50Tmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

82Cvariable

83Cmostly conserved

84Cmostly conserved

85Tmostly conserved

86Gmostly conserved

87Gmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

100Amostly conserved

115Tmostly conserved

127Gvariable

160Gmostly conserved

169Cmostly conserved

172Cmostly conserved

206Cvariable

235Cmostly conserved

364Cvariable

370Tmostly conserved

385Cmostly conserved

401Cmostly conserved

421Amostly conserved

445Tmostly conserved

448Tmostly conserved

469Cmostly conserved

485Tmostly conserved

499Cmostly conserved

500Cmostly conserved

520Amostly conserved

562Tmostly conserved

574Tvariable

613Cvariable

616Tvariable

619Cvariable

622Tvariable

646Tvariable

AACATTATATTTTATCTTTGGTATTTGAGCAGGTTTAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes5

BINs2

Most divergent pair4.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris inanasame genus4.4%Acleris britanniasame genus4.7%Acleris varieganasame genus5.2%Acleris keiferisame genus5.3%Acleris permutanasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type82 records

Wild obs. + sensor43

Museum / vouchered39

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 26≤1 km 6≤10 km 4>10 km 2

38 georeferenced · 5 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤1 km 9≤10 km 1

10 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Royal Saskatchewan Museumlocation not on record	5
Cornell University Insect Collectionlocation not on record	4
Mississippi State, US	3
University of Alberta Museums (UAM)location not on record	2

6 institutions · 31 of 39 vouchered records shown · 8 without an institution code

09Environmental DNA22 detections

Where the DNA of Acleris fragariana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

Mixed habitat4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 11.6–17.9

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.8 °C 13.4–20.5

Min temp (night)11.2 °C 9.20–17.0

Precipitation106 mm/mo 80.2–125

Air humidity61.1 % 59.9–70.0

Moisture balance36.3 mm/mo

Vapour deficit599 Pa 520–640

Wind speed4.80 m/s

Cloud cover44.0 % 34.6–56.5

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)