Acleris keiferi

Powell, 1964 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records21

Data sources8

Biological traits0

DNA specimens6

eDNA detections4

Sources8 archives

Databases and archives Acleris keiferi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF21 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD6 specimens

01Narrative

Acleris keiferi is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from California and Idaho. Adults have been recorded on wing from May to October.mothphotographersgroup The larvae feed on Rosa californica, Rubus ursinus and Fragaria species.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris keiferi has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

50Cmostly conserved

73Gmostly conserved

103Tmostly conserved

130Gmostly conserved

232Tmostly conserved

364Cmostly conserved

391Tmostly conserved

412Tmostly conserved

421Cmostly conserved

433Gvariable

445Cmostly conserved

473Amostly conserved

508Gmostly conserved

523Cmostly conserved

604Cmostly conserved

625Amostly conserved

628Amostly conserved

631Gvariable

AACATTATATTTTATTTTCGGTATTTGAGCAGGTATAGTAGGAACTTCTCTAAGATTATTAATTCGAGCAGAGTTAGGAAATCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BINs2

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris britanniasame genus3.3%Acleris inanasame genus3.8%Acleris varieganasame genus4.0%Acleris subnivanasame genus5.2%Acleris fragarianasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type21 records

Museum / vouchered21

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 1≤1 km 13≤10 km 3

17 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence21

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Essig Museum of Entomologylocation not on record	17
Washington, US	4

2 institutions · 21 of 21 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Acleris keiferi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 14.8–15.8

Seasonal swing summer↔winter7.40 °C

Max temp (day)21.8 °C 19.8–21.8

Min temp (night)11.2 °C 11.2–11.3

Precipitation2.70 mm/mo 2.70–13.8

Air humidity60.7 % 60.7–64.3

Moisture balance-148 mm/mo -148–-99.1

Vapour deficit703 Pa 604–703

Wind speed2.20 m/s 1.50–2.20

Cloud cover23.9 % 23.9–30.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)