Acleris caliginosana

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records225

Data sources8

Biological traits0

DNA specimens33

eDNA detections29

Sources8 archives

Databases and archives Acleris caliginosana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility225 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF225 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD33 specimens

01Narrative

Acleris caliginosana is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, British Columbia, California, Colorado, Idaho, Maine, Montana, New Brunswick, Nova Scotia, Ontario, Quebec, Washington and Wisconsin.mothphotographersgroup The wingspan is 24–29 mm. The ground colour of the forewings is deep purple or grey brown and the hindwings are mottled.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290–332 Adults have been recorded on wing nearly year round. The larvae feed on Alnus incana, Alnus rubra and Betula papyrifera.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris caliginosana has left across the world's sequence archives.

At a glance

DNA specimens33

BINs4

Marker genes1

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 48 variable positions, in barcode order

13Tmostly conserved

31Amostly conserved

34Tmostly conserved

40Avariable

46Tmostly conserved

49Cvariable

50Tvariable

55Avariable

56Tmostly conserved

59Cmostly conserved

82Tvariable

91Amostly conserved

100Tmostly conserved

115Tmostly conserved

121Cmostly conserved

127Tmostly conserved

190Amostly conserved

220Tmostly conserved

229Amostly conserved

235Cmostly conserved

238Avariable

271Cmostly conserved

274Tvariable

286Tmostly conserved

340Cvariable

358Cmostly conserved

364Cvariable

370Tmostly conserved

380Gmostly conserved

400Tvariable

401Cmostly conserved

412Amostly conserved

415Tmostly conserved

418Tmostly conserved

421Amostly conserved

460Cmostly conserved

469Tmostly conserved

475Cmostly conserved

499Tmostly conserved

508Amostly conserved

520Tmostly conserved

542Cmostly conserved

553Amostly conserved

556Avariable

562Amostly conserved

628Amostly conserved

631Amostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCCTTAAGATTACTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes13

BINs4

Most divergent pair6.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris kochiellasame genus4.3%Acleris cristanasame genus4.4%Acleris undulanasame genus4.6%Acleris hyemanasame genus4.6%Acleris maximanasame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type225 records

Wild obs. + sensor165

Museum / vouchered60

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 134≤1 km 3≤10 km 2

139 georeferenced · 26 without coordinates

Open the mapobservation + sensor165

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 7≤1 km 11≤10 km 2>10 km 4

24 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	12
University of Alberta Museums (UAM)location not on record	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Denver, US	6
St. Paul, US	4
New Haven, US	3
Edmonton, CA	3
Research Collection of Daniel Handfieldlocation not on record	1
Washington State Department of Agriculturelocation not on record	1

9 institutions · 49 of 60 vouchered records shown · 11 without an institution code

09Environmental DNA29 detections

Where the DNA of Acleris caliginosana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.00 °C 1.20–11.4

Seasonal swing summer↔winter30.4 °C

Max temp (day)11.2 °C 5.10–16.5

Min temp (night)3.50 °C -2.80–7.90

Precipitation72.0 mm/mo 45.1–166

Air humidity59.3 % 54.2–64.5

Moisture balance-19.2 mm/mo -43.0–123

Vapour deficit396 Pa 287–569

Wind speed3.00 m/s 2.00–4.90

Cloud cover51.9 % 42.0–62.2

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)