Acleris quercinana

(Zeller, 1849) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records80

Data sources8

Biological traits0

DNA specimens6

eDNA detections5

Sources8 archives

Databases and archives Acleris quercinana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF80 records

Environmental DNA1 datasets · 4 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Acleris quercinana is a species of moth of the family Tortricidae. It was described by Zeller in 1849. It is found in most of Europe (except Ireland, Great Britain, Norway, Finland, the Baltic region, Croatia and Slovakia), Asia Minor and Iran. The wingspan is 12 –. Adults have been recorded on wing from June to August., 2009: A brief study on the tribes Tortricini and Archipini (Lepidoptera: Tortricinae) from Iran. Entomofauna Band 30, Heft 10: 137-152. The larvae feed on Quercus species. Larvae can be found from May to June.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris quercinana has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections5

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

22Tmostly conserved

28Amostly conserved

37Gvariable

67Amostly conserved

70Tmostly conserved

100Tmostly conserved

160Amostly conserved

197Tmostly conserved

205Cmostly conserved

206Cmostly conserved

217Gmostly conserved

220Tmostly conserved

232Cmostly conserved

250Tmostly conserved

271Cmostly conserved

274Cmostly conserved

287Tmostly conserved

292Cmostly conserved

304Tmostly conserved

307Amostly conserved

334Amostly conserved

340Tmostly conserved

364Cmostly conserved

373Amostly conserved

379Tmostly conserved

397Tmostly conserved

400Tmostly conserved

424Amostly conserved

433Tmostly conserved

451Gvariable

469Tvariable

472Amostly conserved

485Tmostly conserved

500Cmostly conserved

508Amostly conserved

517Tmostly conserved

529Cmostly conserved

530Tmostly conserved

541Tmostly conserved

548Cmostly conserved

562Amostly conserved

571Cmostly conserved

574Tmostly conserved

577Amostly conserved

586Amostly conserved

622Amostly conserved

628Gmostly conserved

631Tmostly conserved

641Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATGGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes4

BINs2

Most divergent pair7.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris chalybeanasame genus5.4%Acleris cervinanasame genus5.9%Acleris subnivanasame genus5.9%Acleris kochiellasame genus5.9%Acleris sparsanasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type80 records

Wild obs. + sensor35

Museum / vouchered33

Other12

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 7≤1 km 14≤10 km 12

33 georeferenced · 2 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 4≤1 km 9≤10 km 13

26 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	17
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	6
Provincia di Livornolocation not on record	4
SLU Artdatabankenlocation not on record	3
University of Kaiserslauternlocation not on record	1

5 institutions · 31 of 33 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Acleris quercinana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 14.7–21.7

Seasonal swing summer↔winter20.8 °C

Max temp (day)25.4 °C 18.9–26.5

Min temp (night)15.5 °C 9.40–15.7

Precipitation65.3 mm/mo 44.4–93.9

Air humidity55.9 % 55.0–59.2

Moisture balance-61.0 mm/mo -119–-10.7

Vapour deficit1,115 Pa 720–1,163

Wind speed2.70 m/s 2.20–3.50

Cloud cover35.2 % 33.6–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)