Acleris literana

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records2 115

Data sources10

Biological traits2

DNA specimens28

eDNA detections27

Sources10 archives

Databases and archives Acleris literana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 115 records

Environmental DNA1 datasets · 8 countries27 detections

DNA & barcodingBOLD28 specimens

Genome at a glanceGoaT · NCBI≈675 Mbp

01Narrative

Acleris literana, the sprinkled rough-wing, is a moth of the family Tortricidae. The species was first described by Carl Linnaeus in his 1758 10th edition of Systema Naturae. It is found in most of Europe and in the Near East. Illustration from John Curtis's British Entomology Volume 6 It is a variable species and many different forms have been described, but all have a combination of blackish and whitish markings on a pale green ground. Julius von Kennel provides a full description.Julius von Kennel, 1921, The Palaearktischen Tortriciden, eine monographische Darstellung. Stuttgart: E. Schweizerbart'sche Verlagsbuchhandlung. 742 pp. - Palaearctic Tortricidae, a monograph.pdf at Zobodat 82-83 The wingspan is . Adults are on wing from August to September and again from April to May after overwintering as an adult. The larvae feed on Quercus species. They live between leaves spun together with silk. Acleris literana.jpg Acleris literana-o.jpg

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris literana has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

eDNA detections27

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

250Cvariable

286Tmostly conserved

343Tmostly conserved

373Amostly conserved

508Gmostly conserved

619Tvariable

625Gvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes14

BIN1

Most divergent pair0.91%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris kochiellasame genus4.9%Acleris roscidanasame genus5.0%Acleris maximanasame genus5.3%Acleris maculidorsanasame genus5.5%Acleris lipsianasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acleris literana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈674 873 004 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris literana0.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.1% BUSCO

08Occurrence & distribution

Record type2 115 records

Wild obs. + sensor1 808

Museum / vouchered262

Other45

Range

Area of Occupancy AOO4 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 882≤1 km 393≤10 km 408>10 km 8

1 691 georeferenced · 117 without coordinates

Open the mapobservation + sensor1 808

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 80≤1 km 89≤10 km 50>10 km 4

223 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence262

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	82
NHMOlocation not on record	46
Provincia di Livornolocation not on record	37
SLU Artdatabankenlocation not on record	18
Tartu, EE	14
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	13
Natural History Museum Rotterdamlocation not on record	8
CBDClocation not on record	7
Radicondoli, IT	6
Cambridge, US	4
NTNU-VMlocation not on record	4
ZSMlocation not on record	2
NMBU:MINAlocation not on record	2
New Haven, US	1
Salzburg, AT	1
Philadelphia, US	1
Durban Natural Science Museumlocation not on record	1
Stockholm, SE	1
Nijmegen, NL	1
University of Kaiserslauternlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
neflocation not on record	1

23 institutions · 253 of 262 vouchered records shown · 9 without an institution code

09Environmental DNA27 detections

Where the DNA of Acleris literana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map8 countries0

birch standjuniperus forestnatural woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 5.80–20.0

Seasonal swing summer↔winter16.4 °C

Max temp (day)14.5 °C 8.40–24.6

Min temp (night)7.10 °C 1.70–15.1

Precipitation61.1 mm/mo 47.8–134

Air humidity59.6 % 55.2–63.3

Moisture balance-23.8 mm/mo -69.7–76.8

Vapour deficit552 Pa 360–995

Wind speed3.00 m/s 2.00–5.50

Cloud cover40.8 % 36.2–47.4

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris literana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 115 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 115 records