Acleris bergmanniana

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records6 242

Data sources10

Biological traits2

DNA specimens47

eDNA detections48

Sources10 archives

Databases and archives Acleris bergmanniana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 242 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF6 242 records

Environmental DNA2 datasets · 10 countries48 detections

DNA & barcodingBOLD47 specimens

Genome at a glanceGoaT · NCBI≈506 Mbp

01Narrative

Acleris bergmanniana, the yellow rose button moth, is a moth of the family Tortricidae. It is found from most of Europe to the eastern Palearctic realm.Fauna Europaea The wingspan is 12–15 mm.microlepidoptera.nl The forewings are marked with metallic blue-grey striations, edged with rufous. There are also two small raised tufts of black scales.Julius von Kennel. 1921, The Palaearktischen Tortriciden, eine monographische Darstellung. Stuttgart: E. Schweizerbart'sche Verlagsbuchhandlung. 742 pp. - Palaearctic Tortricidae, a monograph.pdf at Zobodat 172 Adults are on wing from June to July.UK Moths The larvae feed on the leaves and shoots of rose Rosa species (Rosa canina), as well as Rhamnus cathartica.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris bergmanniana has left across the world's sequence archives.

At a glance

DNA specimens47

BINs2

Marker genes1

eDNA detections48

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

115Cmostly conserved

118Tmostly conserved

220Cmostly conserved

232Tmostly conserved

337Cmostly conserved

364Amostly conserved

625Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes7

BINs2

Most divergent pair2.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris albicomanasame genus4.0%Acleris kochiellasame genus5.8%Acleris sparsanasame genus5.9%Acleris varieganasame genus6.1%Acleris forsskaleanasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acleris bergmanniana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈505 792 038 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris bergmanniana0.51 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.5% BUSCO

08Occurrence & distribution

Record type6 242 records

Wild obs. + sensor5 466

Museum / vouchered732

Other44

Origin

Native97

Range

Area of Occupancy AOO8 928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 2 214≤1 km 956≤10 km 1 504>10 km 16

4 690 georeferenced · 776 without coordinates

Open the mapobservation + sensor5 466

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 288≤1 km 156≤10 km 92>10 km 1

537 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence732

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	190
NHMOlocation not on record	93
Tartu, EE	58
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	48
SLU Artdatabankenlocation not on record	41
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	37
Philadelphia, US	31
Stockholm, SE	27
Kuopio, FI	27
NTNU-VMlocation not on record	26
Natural History Museum Rotterdamlocation not on record	23
RMZlocation not on record	16
Nijmegen, NL	14
Provincia di Livornolocation not on record	10
Rovaniemi, FI	8
DABUHlocation not on record	6
Salzburg, AT	5
Tallinn, EE	3
University of Kaiserslauternlocation not on record	3
BioFokuslocation not on record	2
NMBU:MINAlocation not on record	2
Uniwersytet Łódzkilocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
ZMAAlocation not on record	1
ZSMlocation not on record	1
Brussels, BE	1
MZLUlocation not on record	1

31 institutions · 681 of 732 vouchered records shown · 51 without an institution code

09Environmental DNA48 detections

Where the DNA of Acleris bergmanniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys2

Countries10

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map10 countries0

dry grasslandedge forestUrbaninside forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 9.20–18.1

Seasonal swing summer↔winter19.4 °C

Max temp (day)18.7 °C 14.0–22.2

Min temp (night)10.9 °C 3.70–13.2

Precipitation86.1 mm/mo 59.1–143

Air humidity59.4 % 57.0–64.9

Moisture balance-38.0 mm/mo -66.7–105

Vapour deficit691 Pa 421–871

Wind speed2.80 m/s 2.20–3.80

Cloud cover38.0 % 35.3–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris bergmanniana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type6 242 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 242 records