Acleris albicomana

(Clemens, 1865) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records592

Data sources8

Biological traits0

DNA specimens175

eDNA detections175

Sources8 archives

Databases and archives Acleris albicomana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility592 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI175 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics175 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF592 records

Environmental DNA1 datasets · 2 countries175 detections

DNA & barcodingBOLD175 specimens

01Narrative

Acleris albicomana, the red-edged acleris moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, Arizona, British Columbia, California, Colorado, Florida, Illinois, Indiana, Iowa, Kentucky, Maine, Manitoba, Maryland, Minnesota, Montana, New Mexico, New York, North Carolina, Ohio, Ontario, Oregon, Pennsylvania, Saskatchewan, Tennessee, Virginia and Utah.mothphotographersgroup The wingspan is 12–14 mm. Adults have been recorded on wing from April to September. The larvae feed on Gaylussacia, Vaccinium and Quercus species, as well as Rosa californica and Rosa gymnocarpa.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding175 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris albicomana has left across the world's sequence archives.

At a glance

DNA specimens175

BINs1

Marker genes1

eDNA detections175

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus173 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

68Gmostly conserved

229Gmostly conserved

544Cmostly conserved

559Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes9

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris bergmannianasame genus4.0%Acleris forsskaleanasame genus6.5%Acleris folianasame genus6.8%Acleris lipsianasame genus6.8%Aleimma loeflingianasame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type592 records

Wild obs. + sensor278

Museum / vouchered314

Range

Area of Occupancy AOO1 072 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 161≤1 km 26≤10 km 8>10 km 17

212 georeferenced · 66 without coordinates

Open the mapobservation + sensor278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 22≤1 km 6≤10 km 29>10 km 22

79 georeferenced · 235 without coordinates

Open the institutions mapphysical evidence314

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	66
East Lansing, US	50
University of Guelph, Centre for Biodiversity Genomicslocation not on record	41
St. Paul, US	33
Mississippi State, US	20
Colorado State Universitylocation not on record	9
Denver, US	8
San Francisco, US	6
Royal Saskatchewan Museumlocation not on record	5
ASUlocation not on record	4
Cornell University Insect Collectionlocation not on record	4
Vernal, US	3
Centre for Biodiversity Genomicslocation not on record	3
Edmonton, CA	2
New Haven, US	1
Decorah, US	1

16 institutions · 256 of 314 vouchered records shown · 58 without an institution code

09Environmental DNA175 detections

Where the DNA of Acleris albicomana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found175

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 175 detections have coordinates

Open the map2 countries0

Grassland4. Native GrasslandMixed habitatMixed HabitatForest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 15.7–17.4

Seasonal swing summer↔winter24.3 °C

Max temp (day)21.5 °C 18.0–23.2

Min temp (night)11.0 °C 10.4–14.0

Precipitation59.3 mm/mo 42.3–123

Air humidity57.2 % 56.6–60.7

Moisture balance-63.6 mm/mo -71.4–10.5

Vapour deficit791 Pa 697–882

Wind speed1.40 m/s 1.10–2.60

Cloud cover40.9 % 36.5–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 171 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)