Sphinx vashti

Strecker · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Sphinx

At a glance

Occurrence records2 240

Data sources7

Biological traits0

DNA specimens59

eDNA detections58

Sources7 archives

Databases and archives Sphinx vashti's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 240 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics59 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 240 records

Environmental DNA1 datasets · 2 countries58 detections

DNA & barcodingBOLD59 specimens

01Narrative

Sphinx vashti, the Vashti sphinx, is a member of the family Sphingidae of moths. It is found in North America from British Columbia east to Manitoba, south to southern California, Nevada, central Arizona, New Mexico and western Texas. The pattern and wing length are highly variable. The forewing ranges from pale to very dark gray with paler gray at the base of the costa, the wing tip, and on the outer margin. A series of black dashes ends with the topmost one reaching the wing tip. The hindwing is black with white bands. There is one brood per year. The larva feed on snowberry (Symphoricarpos albus) and coralberry (Symphoricarpos orbiculatus)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding59 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphinx vashti has left across the world's sequence archives.

At a glance

DNA specimens59

BINs2

Marker genes1

eDNA detections58

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

67Gvariable

169Tvariable

217Gvariable

262Avariable

271Cvariable

274Tvariable

287Cvariable

355Tvariable

466Amostly conserved

556Gvariable

616Cvariable

625Gvariable

646Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGGGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes11

BINs2

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphinx dolliisame genus2.6%Sphinx sequoiaesame genus3.5%Sphinx drupiferarumsame genus3.8%Sphinx pereleganssame genus4.0%Sphinx asellussame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 240 records

Wild obs. + sensor1 364

Museum / vouchered876

Range

Area of Occupancy AOO4 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 794≤1 km 138≤10 km 102>10 km 74

1 108 georeferenced · 256 without coordinates

Open the mapobservation + sensor1 364

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 158≤1 km 88≤10 km 172>10 km 68

486 georeferenced · 390 without coordinates

Open the institutions mapphysical evidence876

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	300
University of Alberta Museums (UAM)location not on record	151
New Haven, US	133
Vancouver, CA	45
Royal Saskatchewan Museumlocation not on record	44
Vernal, US	37
St. Paul, US	24
Denver, US	19
King Saud Universitylocation not on record	15
Natural History Museum of Utahlocation not on record	12
Cleveland Museum of Natural History, OH (CLEV)location not on record	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
San Francisco, US	9
ASUlocation not on record	8
Awka, NG	5
Cornell University Insect Collectionlocation not on record	5
Georgia Museum of Natural Historylocation not on record	4
Essig Museum of Entomologylocation not on record	4
East Lansing, US	3
University of California, Davislocation not on record	3
WWUlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Chicago, US	2
National Institute of Biological Resourceslocation not on record	2
University of Alabamalocation not on record	2
Zürich, CH	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
Champaign, US	1

29 institutions · 853 of 876 vouchered records shown · 23 without an institution code

09Environmental DNA58 detections

Where the DNA of Sphinx vashti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map2 countries0

Riparian ZoneGrasslandMixed HabitatForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 11.1–19.6

Seasonal swing summer↔winter24.8 °C

Max temp (day)22.2 °C 17.5–26.9

Min temp (night)10.0 °C 5.00–14.0

Precipitation52.6 mm/mo 30.7–83.8

Air humidity52.1 % 49.4–54.6

Moisture balance-83.0 mm/mo -135–-51.8

Vapour deficit885 Pa 654–1,112

Wind speed2.60 m/s 1.50–4.20

Cloud cover37.5 % 24.7–40.6

CHELSA 1981–2010, ~9 km grid, at location & month of 55 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphinx vashti

At a glance

Sources7 archives

At a glance

Record type2 240 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 240 records