Sphinx dollii

Neumoegen, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Sphinx

At a glance

Occurrence records763

Data sources6

Biological traits0

DNA specimens44

eDNA detections45

Sources6 archives

Databases and archives Sphinx dollii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility763 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF763 records

Environmental DNA1 datasets · 2 countries45 detections

DNA & barcodingBOLD44 specimens

01Narrative

Sphinx dollii est une espèce nord-américaine de lépidoptères (papillons) de la famille des Sphingidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphinx dollii has left across the world's sequence archives.

At a glance

DNA specimens44

BINs1

Marker genes1

eDNA detections45

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

67Gmostly conserved

133Tvariable

160Amostly conserved

217Gmostly conserved

238Cvariable

340Cvariable

376Tmostly conserved

401Tvariable

416Amostly conserved

418Tmostly conserved

433Avariable

466Gmostly conserved

517Amostly conserved

562Avariable

565Gvariable

646Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGGGCAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes14

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphinx vashtisame genus2.6%Sphinx sequoiaesame genus2.7%Sphinx asellussame genus3.0%Sphinx pereleganssame genus3.2%Sphinx canadensissame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type763 records

Wild obs. + sensor399

Museum / vouchered364

Range

Area of Occupancy AOO1 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 182≤1 km 38≤10 km 43>10 km 61

324 georeferenced · 75 without coordinates

Open the mapobservation + sensor399

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 29≤1 km 37≤10 km 199>10 km 33

298 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence364

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	100
New Haven, US	59
ASUlocation not on record	48
East Lansing, US	31
Awka, NG	21
US	12
Universidad Católica de Manizaleslocation not on record	11
University of Alabamalocation not on record	10
Mississippi State, US	10
University of California, Davislocation not on record	9
München, DE	7
Philadelphia, US	6
University of Alberta Museums (UAM)location not on record	6
Denver, US	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
Essig Museum of Entomologylocation not on record	4
Milwaukee Public Museum (MPM)location not on record	4
Natural History Museum of Utahlocation not on record	2
Georgia Museum of Natural Historylocation not on record	2
Facultad de Ciencias Biológicas y Agropecuarias, Universidad de Colimalocation not on record	1
Cornell University Insect Collectionlocation not on record	1
WWUlocation not on record	1
OSUClocation not on record	1
Washington, US	1
South Kensington, GB	1
Chicago, US	1
Albuquerque, US	1
Champaign, US	1

28 institutions · 363 of 364 vouchered records shown · 1 without an institution code

09Environmental DNA45 detections

Where the DNA of Sphinx dollii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 20.4–25.0

Seasonal swing summer↔winter20.1 °C

Max temp (day)29.6 °C 26.2–31.2

Min temp (night)16.4 °C 14.8–19.0

Precipitation82.2 mm/mo 82.2–126

Air humidity47.3 % 47.3–52.4

Moisture balance-80.5 mm/mo -80.5–-15.5

Vapour deficit1,462 Pa 1,137–1,631

Wind speed1.10 m/s 1.00–2.30

Cloud cover21.1 % 15.5–21.2

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)