Sphinx perelegans

Edwards, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Sphinx

At a glance

Occurrence records1 067

Data sources7

Biological traits0

DNA specimens30

eDNA detections28

Sources7 archives

Databases and archives Sphinx perelegans's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 067 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 067 records

Environmental DNA1 datasets · 3 countries28 detections

DNA & barcodingBOLD30 specimens

01Narrative

Sphinx perelegans, the elegant sphinx, is a species of hawkmoth.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphinx perelegans has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections28

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

235Cmostly conserved

400Gmostly conserved

628Gmostly conserved

631Avariable

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes8

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphinx asellussame genus2.3%Sphinx dolliisame genus3.2%Sphinx chersissame genus3.5%Sphinx sequoiaesame genus3.6%Sphinx canadensissame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 067 records

Wild obs. + sensor742

Museum / vouchered323

Other2

Origin

Native1

Range

Area of Occupancy AOO2 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 389≤1 km 81≤10 km 43>10 km 72

585 georeferenced · 157 without coordinates

Open the mapobservation + sensor742

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 18≤1 km 31≤10 km 73>10 km 80

202 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence323

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	106
San Diego, US	35
Santa Barbara Museum of Natural Historylocation not on record	32
Colorado State Universitylocation not on record	23
San Francisco, US	16
Essig Museum of Entomologylocation not on record	15
St. Paul, US	11
Vancouver, CA	10
OSUClocation not on record	10
University of Central Floridalocation not on record	10
University of Alberta Museums (UAM)location not on record	6
East Lansing, US	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
Mexico City, MX	4
Vernal, US	4
Georgia Museum of Natural Historylocation not on record	4
Chicago, US	3
National Institute of Biological Resourceslocation not on record	3
University of California, Davislocation not on record	2
ASUlocation not on record	2
Natural History Museum of Utahlocation not on record	1
Los Angeles, US	1
Denver, US	1
Centre for Biodiversity Genomicslocation not on record	1
Mississippi State, US	1
Zürich, CH	1
Chicago, US	1
Philadelphia, US	1

28 institutions · 315 of 323 vouchered records shown · 8 without an institution code

09Environmental DNA28 detections

Where the DNA of Sphinx perelegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map3 countries0

Pines

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 16.1–23.3

Seasonal swing summer↔winter15.8 °C

Max temp (day)24.0 °C 21.0–31.6

Min temp (night)10.4 °C 9.70–17.5

Precipitation7.70 mm/mo 2.70–52.6

Air humidity51.4 % 45.3–57.1

Moisture balance-149 mm/mo -168–-72.8

Vapour deficit916 Pa 798–1,591

Wind speed1.90 m/s 1.50–3.10

Cloud cover23.0 % 14.5–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphinx perelegans

At a glance

Sources7 archives

At a glance

Record type1 067 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 067 records