Sphinx asellus

Rothschild & Jordan, 1903 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Sphinx

At a glance

Occurrence records164

Data sources6

Biological traits0

DNA specimens11

eDNA detections9

Sources6 archives

Databases and archives Sphinx asellus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility164 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF164 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD11 specimens

01Narrative

Sphinx asellus, the asellus sphinx moth, is a moth of the family Sphingidae. The species was first described by Walter Rothschild and Karl Jordan in 1903. It is known from pinyon-juniper woodland and similar arid areas in the US states of Colorado, Nevada, Utah, extreme south-western Wyoming, Arizona, New Mexico and south-western Texas. The wingspan is 80–99 mm. There is one generation per year with adults on wing from May to July. The larvae feed on manzanita species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphinx asellus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

28Amostly conserved

40Amostly conserved

82Tmostly conserved

92Tvariable

112Tmostly conserved

145Cvariable

160Amostly conserved

197Cvariable

212Cvariable

250Cvariable

262Gvariable

287Tvariable

319Tvariable

346Tvariable

373Tmostly conserved

379Avariable

400Avariable

427Tmostly conserved

466Gvariable

484Amostly conserved

517Amostly conserved

532Cvariable

548Cvariable

568Amostly conserved

577Avariable

601Tmostly conserved

616Tvariable

628Ahighly variable

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes6

BINs3

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphinx pereleganssame genus2.3%Sphinx dolliisame genus3.0%Sphinx chersissame genus3.8%Sphinx canadensissame genus4.0%Sphinx sequoiaesame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type164 records

Wild obs. + sensor60

Museum / vouchered104

Range

Area of Occupancy AOO404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 23≤1 km 15≤10 km 10>10 km 4

52 georeferenced · 8 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 22≤1 km 10≤10 km 50>10 km 11

93 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	54
Colorado State Universitylocation not on record	27
University of Alabamalocation not on record	8
Universidad Católica de Manizaleslocation not on record	3
East Lansing, US	3
New Haven, US	2
Natural History Museum of Utahlocation not on record	2
Denver, US	1
Mississippi State, US	1
Facultad de Ciencias Biológicas y Agropecuarias, Universidad de Colimalocation not on record	1
Essig Museum of Entomologylocation not on record	1

11 institutions · 103 of 104 vouchered records shown · 1 without an institution code

09Environmental DNA9 detections

Where the DNA of Sphinx asellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 18.6–26.6

Seasonal swing summer↔winter17.8 °C

Max temp (day)31.0 °C 25.3–32.8

Min temp (night)19.1 °C 12.3–20.7

Precipitation115 mm/mo 54.0–236

Air humidity50.2 % 48.7–55.8

Moisture balance-59.4 mm/mo -107–75.9

Vapour deficit1,508 Pa 955–1,740

Wind speed2.20 m/s 1.70–2.40

Cloud cover17.8 % 16.5–25.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)