Sphinx drupiferarum

Smith, 1797 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Sphinx

At a glance

Occurrence records1 086

Data sources7

Biological traits2

DNA specimens11

eDNA detections11

Sources7 archives

Databases and archives Sphinx drupiferarum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 086 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 086 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Sphinx drupiferarum, the wild cherry sphinx, is a moth of the family Sphingidae. The species was first described by James Edward Smith in 1797.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphinx drupiferarum has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

82Cmostly conserved

212Tmostly conserved

220Amostly conserved

250Cmostly conserved

562Amostly conserved

601Tmostly conserved

607Amostly conserved

625Avariable

628Avariable

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes6

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphinx sequoiaesame genus3.6%Sphinx vashtisame genus3.8%Lapara phaeobrachyceroussame family4.0%Sphinx dolliisame genus4.0%Lapara bombycoidessame family4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 086 records

Wild obs. + sensor746

Museum / vouchered340

Range

Area of Occupancy AOO3 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 378≤1 km 83≤10 km 53>10 km 148

662 georeferenced · 84 without coordinates

Open the mapobservation + sensor746

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 14≤1 km 53≤10 km 133>10 km 42

242 georeferenced · 98 without coordinates

Open the institutions mapphysical evidence340

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	95
East Lansing, US	69
Colorado State Universitylocation not on record	19
Cleveland Museum of Natural History, OH (CLEV)location not on record	16
Philadelphia, US	14
St. Paul, US	14
Royal Saskatchewan Museumlocation not on record	13
Vernal, US	12
Georgia Museum of Natural Historylocation not on record	9
University of Alberta Museums (UAM)location not on record	9
Cambridge, US	7
Natural History Museum of Utahlocation not on record	7
Vancouver, CA	6
Toronto, CA	6
Saint John, CA	5
King Saud Universitylocation not on record	4
San Francisco, US	3
University of Central Floridalocation not on record	3
SOVTlocation not on record	3
CUlocation not on record	2
Chicago, US	2
US	2
Champaign, US	2
Essig Museum of Entomologylocation not on record	2
UDlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Mississippi State, US	1
Chicago, US	1
ASUlocation not on record	1

30 institutions · 331 of 340 vouchered records shown · 9 without an institution code

09Environmental DNA11 detections

Where the DNA of Sphinx drupiferarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 10.1–17.9

Seasonal swing summer↔winter26.1 °C

Max temp (day)18.5 °C 13.8–23.0

Min temp (night)7.90 °C 3.50–13.0

Precipitation81.7 mm/mo 33.6–93.5

Air humidity55.2 % 52.7–58.9

Moisture balance-46.9 mm/mo -91.7–-30.7

Vapour deficit649 Pa 512–856

Wind speed2.90 m/s 2.30–5.20

Cloud cover43.5 % 41.5–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphinx drupiferarum

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 086 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 086 records