Sphinx luscitiosa

Clemens, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Sphinx

At a glance

Occurrence records294

Data sources6

Biological traits0

DNA specimens7

eDNA detections0

Sources6 archives

Databases and archives Sphinx luscitiosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility294 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF294 records

DNA & barcodingBOLD7 specimens

01Narrative

Sphinx luscitiosa, or Clemens' hawkmoth, is a moth of the family Sphingidae. The species was first described by James Brackenridge Clemens in 1859. It is found in North America from Nova Scotia south to New Jersey, west through Michigan, Wisconsin and the northern plains to Alberta, Saskatchewan and Montana and south to Utah. It has been taken as far north as Yukon. The wingspan is 56–80 mm. There is one generation per year with adults on wing from June to July. The larvae feed on Salix, Populus, Malus, Fraxinus, Morella and Betula species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphinx luscitiosa has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.43%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

133Cvariable

313Tvariable

556Gvariable

568Avariable

578Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphinx poecilasame genus2.3%Sphinx dolliisame genus4.4%Sphinx pereleganssame genus4.6%Sphinx drupiferarumsame genus4.6%Sphinx sequoiaesame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type294 records

Wild obs. + sensor148

Museum / vouchered146

Range

Area of Occupancy AOO828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 42≤1 km 14≤10 km 14>10 km 66

136 georeferenced · 12 without coordinates

Open the mapobservation + sensor148

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 1≤1 km 32≤10 km 38>10 km 21

92 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	47
New Haven, US	31
Toronto, CA	13
University of Alberta Museums (UAM)location not on record	9
St. Paul, US	9
Cleveland Museum of Natural History, OH (CLEV)location not on record	8
Royal Saskatchewan Museumlocation not on record	7
Colorado State Universitylocation not on record	4
San Diego, US	3
Philadelphia, US	2
Vernal, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
OSUClocation not on record	1
Brussels, BE	1
Saint John, CA	1
RBINS-Scientific Heritagelocation not on record	1

16 institutions · 139 of 146 vouchered records shown · 7 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)