Sphinx poecila

Stephens, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Sphinx

At a glance

Occurrence records1 743

Data sources7

Biological traits0

DNA specimens41

eDNA detections41

Sources7 archives

Databases and archives Sphinx poecila's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 743 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 743 records

Environmental DNA1 datasets · 2 countries41 detections

DNA & barcodingBOLD41 specimens

01Narrative

Sphinx poecila, the poecila sphinx, is a moth of the family Sphingidae. It is found from Newfoundland and Maine south to Pennsylvania and west to Michigan, northeastern Illinois and Wisconsin. The wingspan is 68–95 mm. The larvae feed on Rosa carolina, Picea glauca, Larix laricina and Alnus, Malus, Myrica and Vaccinium species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphinx poecila has left across the world's sequence archives.

At a glance

DNA specimens41

BINs2

Marker genes1

eDNA detections41

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

367Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes5

BINs2

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphinx luscitiosasame genus2.3%Sphinx gordiussame genus2.6%Sphinx sequoiaesame genus4.3%Sphinx drupiferarumsame genus4.7%Sphinx dolliisame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 743 records

Wild obs. + sensor1 356

Museum / vouchered387

Range

Area of Occupancy AOO3 416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 794≤1 km 173≤10 km 79>10 km 70

1 116 georeferenced · 240 without coordinates

Open the mapobservation + sensor1 356

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 1≤1 km 138≤10 km 121>10 km 25

285 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence387

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	232
East Lansing, US	23
University of Alberta Museums (UAM)location not on record	21
Cambridge, US	16
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
St. Paul, US	15
Royal Saskatchewan Museumlocation not on record	11
Brussels, BE	8
RBINS-Scientific Heritagelocation not on record	5
Toronto, CA	2
South Kensington, GB	1
SOVTlocation not on record	1
Honolulu, US	1

13 institutions · 352 of 387 vouchered records shown · 35 without an institution code

09Environmental DNA41 detections

Where the DNA of Sphinx poecila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map2 countries0

Temperate mixed forestRiparian ZoneBeach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 11.4–21.0

Seasonal swing summer↔winter28.3 °C

Max temp (day)20.0 °C 14.2–26.0

Min temp (night)12.4 °C 6.70–17.2

Precipitation90.1 mm/mo 65.2–111

Air humidity60.3 % 56.3–63.5

Moisture balance-26.1 mm/mo -66.9–66.7

Vapour deficit733 Pa 528–1,030

Wind speed2.80 m/s 2.10–5.30

Cloud cover42.8 % 38.9–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphinx poecila

At a glance

Sources7 archives

At a glance

Record type1 743 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 743 records