Mechanitis menapis

Hewitson, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Mechanitis

At a glance

Occurrence records840

Data sources9

Biological traits0

DNA specimens21

eDNA detections17

Sources9 archives

Databases and archives Mechanitis menapis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility840 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF840 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD21 specimens

Genome at a glanceGoaT · NCBI≈305 Mbp

01Narrative

Mechanitis menapis, the Menapis tigerwing or variable tigerwing, is a species of butterfly of the family Nymphalidae. It was described by William Chapman Hewitson in 1856. It is found in South America. The larvae feed on Solanum species, including S. hispidum and S. torvum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mechanitis menapis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs3

Marker genes1

eDNA detections17

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P475 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

65Tmostly conserved

68Amostly conserved

92Gmostly conserved

191Cmostly conserved

192Tmostly conserved

214Tmostly conserved

233Amostly conserved

251Tmostly conserved

266Tmostly conserved

278Gmostly conserved

311Amostly conserved

398Tvariable

407Cmostly conserved

473Gmostly conserved

TAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes7

BINs2

Most divergent pair2.3%

OtherS.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mechanitis lysimniasame genus2.1%Mechanitis polymniasame genus2.3%Mechanitis isthmiasame genus2.3%Mechanitis mazaeussame genus2.9%Scada kusasame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mechanitis menapis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈305 297 686 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Mechanitis menapis0.31 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.8% BUSCO

08Occurrence & distribution

Record type840 records

Wild obs. + sensor278

Museum / vouchered499

Other63

Origin

Native7

Range

Area of Occupancy AOO1 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 123≤1 km 68≤10 km 22>10 km 9

222 georeferenced · 56 without coordinates

Open the mapobservation + sensor278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 145≤1 km 48≤10 km 43>10 km 19

255 georeferenced · 244 without coordinates

Open the institutions mapphysical evidence499

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	105
Ciudad de México, MX	96
FLMNH-UFlocation not on record	69
Caja de Compensación Familiar - Comfenalco Antioquialocation not on record	48
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	44
Tapachula, MX	14
Tuxtla Gutiérrez, MX	13
Universidad de Antioquia (UdeA)location not on record	13
Chongqing Museumlocation not on record	12
New Haven, US	9
Ciudad de México, MX	9
San Francisco, US	8
Universidad Nacional de Colombia (UNAL)location not on record	7
Ciudad de México, MX	6
Cambridge, US	5
Natural History Museum of Utahlocation not on record	4
Universidad del Valle de Guatemalalocation not on record	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	3
Tartu, EE	2
Brussels, BE	2
RBINS-Scientific Heritagelocation not on record	2
Musée des Confluenceslocation not on record	2
Los Angeles, US	2
Georgia Museum of Natural Historylocation not on record	1
Chicago, US	1
University of Memphislocation not on record	1

27 institutions · 485 of 499 vouchered records shown · 14 without an institution code

09Environmental DNA17 detections

Where the DNA of Mechanitis menapis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.9. Subtropical/Tropic…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 23.0–23.8

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.2 °C 25.5–27.0

Min temp (night)21.0 °C 20.3–21.1

Precipitation280 mm/mo 209–393

Air humidity70.8 % 67.6–73.2

Moisture balance158 mm/mo 82.8–260

Vapour deficit787 Pa 750–905

Wind speed2.30 m/s 2.10–4.00

Cloud cover27.1 % 19.5–41.4

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)