Mechanitis lysimnia

(Fabricius, 1793) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Mechanitis

At a glance

Occurrence records993

Data sources9

Biological traits0

DNA specimens142

eDNA detections74

Sources9 archives

Databases and archives Mechanitis lysimnia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility993 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI74 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics142 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF993 records

Environmental DNA1 datasets · 6 countries74 detections

DNA & barcodingBOLD142 specimens

Genome at a glanceGoaT · NCBI≈320 Mbp

01Narrative

Mechanitis lysimnia, the confused tigerwing, sweet-oil tiger or lysimnia tigerwing, is a species of butterfly of the family Nymphalidae. It was described by Johan Christian Fabricius in 1793. It is found in Central and South America, from southern Mexico to Uruguay. The habitat consists of disturbed forests at altitudes up to 1500 m. Adults have been recorded feeding on nectar from Eupatorium flowers. The larvae are gregarious and feed on Solanum species and possibly other members of the family Solanaceae. They are pale green streaked with yellow.Sweet-oil Tiger, Butterflies of the Amazon and Andes

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding142 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mechanitis lysimnia has left across the world's sequence archives.

At a glance

DNA specimens142

BINs2

Marker genes1

eDNA detections74

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus118 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

5Cvariable

34Avariable

73Avariable

82Tvariable

88Cvariable

103Tvariable

166Avariable

169Cvariable

181Amostly conserved

212Tvariable

217Avariable

229Avariable

274Tmostly conserved

316Avariable

340Cmostly conserved

343Cvariable

346Cmostly conserved

358Tvariable

364Tvariable

370Avariable

401Cvariable

403Avariable

421Avariable

448Tvariable

477Avariable

499Tvariable

565Gvariable

577Avariable

619Amostly conserved

628Amostly conserved

643Cvariable

AACACTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACATCTCTTAGTTTAATAATTCGAACTGAATTAGGAACTCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes17

BINs2

Most divergent pair4.4%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mechanitis mazaeussame genus1.6%Mechanitis polymniasame genus1.6%Mechanitis isthmiasame genus1.7%Mechanitis menapissame genus2.1%Episcada apuleiasame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mechanitis lysimnia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈320 082 018 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Mechanitis lysimnia0.32 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type993 records

Wild obs. + sensor670

Museum / vouchered276

Other47

Range

Area of Occupancy AOO2 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 251≤1 km 147≤10 km 88>10 km 37

523 georeferenced · 147 without coordinates

Open the mapobservation + sensor670

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 10≤1 km 13≤10 km 28>10 km 41

92 georeferenced · 184 without coordinates

Open the institutions mapphysical evidence276

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UNICAMPlocation not on record	52
New Haven, US	37
PUC-RSlocation not on record	25
Musée des Confluenceslocation not on record	19
Cambridge, US	15
Zürich, CH	15
MZLUlocation not on record	9
Tartu, EE	7
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
The University of the West Indies, Trinidad and Tobagolocation not on record	5
National Biodiversity Institute, Costa Ricalocation not on record	5
Grupo Prodecolocation not on record	5
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
Auckland, NZ	3
Natural History Museum of Utahlocation not on record	2
Universidad Nacional de Colombia (UNAL)location not on record	2
Brussels, BE	2
Jardín Botánico Del Quindío (JBQ)location not on record	2
Stockholm, SE	1
Bernardino Rivadavia Natural Sciences Museumlocation not on record	1
University of Pennsylvanialocation not on record	1
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1
RBINS-Scientific Heritagelocation not on record	1

23 institutions · 220 of 276 vouchered records shown · 56 without an institution code

09Environmental DNA74 detections

Where the DNA of Mechanitis lysimnia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found74

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 74 detections have coordinates

Open the map6 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…Dry forestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 21.2–26.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.2 °C 24.9–29.0

Min temp (night)21.4 °C 18.3–23.7

Precipitation327 mm/mo 148–418

Air humidity70.5 % 65.9–76.0

Moisture balance184 mm/mo 13.1–288

Vapour deficit883 Pa 665–1,049

Wind speed2.30 m/s 1.20–3.70

Cloud cover34.2 % 19.0–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 65 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)