Mechanitis polymnia

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Mechanitis

At a glance

Occurrence records1 832

Data sources9

Biological traits0

DNA specimens85

eDNA detections162

Sources9 archives

Databases and archives Mechanitis polymnia's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 832 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI162 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics85 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 832 records

Environmental DNA1 datasets · 5 countries162 detections

DNA & barcodingBOLD85 specimens

Genome at a glanceGoaT · NCBI≈296 Mbp

01Narrative

Mechanitis polymnia, the orange-spotted tiger clearwing or disturbed tigerwing,Glassberg, Jeffrey (2007). A Swift Guide to the Butterflies of Mexico and Central America. Sunstreak Books Inc. . p.145. is a butterfly of the family Nymphalidae. It is found from Mexico to the Amazon rainforest. The wingspan is 65 -. The larvae feed on Solanum species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding85 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mechanitis polymnia has left across the world's sequence archives.

At a glance

DNA specimens85

BINs5

Marker genes3

eDNA detections162

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P622 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

6Avariable

39Gmostly conserved

45Avariable

135Cmostly conserved

147Amostly conserved

150Amostly conserved

201Tmostly conserved

204Tmostly conserved

219Amostly conserved

232Tvariable

234Avariable

249Cvariable

250Tmostly conserved

253Tmostly conserved

306Tvariable

309Tvariable

312Tmostly conserved

324Cmostly conserved

336Amostly conserved

339Amostly conserved

342Cmostly conserved

345Amostly conserved

366Cmostly conserved

378Tmostly conserved

531Avariable

540Tmostly conserved

543Avariable

582Tmostly conserved

585Amostly conserved

612Cmostly conserved

ATAGTAGGAACATCTCTTAGTTTAATAATTCGAACTGAGTTAGGAACCCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes19

BINs5

Most divergent pair3.5%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mechanitis lysimniasame genus1.6%Mechanitis menapissame genus2.3%Mechanitis mazaeussame genus2.6%Episcada apuleiasame family7.2%Scada xanthinasame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PEF1-alphaWnt1

animal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mechanitis polymnia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈295 862 511 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Mechanitis polymnia0.30 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.4% BUSCO

08Occurrence & distribution

Record type1 832 records

Wild obs. + sensor1 340

Museum / vouchered449

Other43

Origin

Native39

Range

Area of Occupancy AOO3 948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 497≤1 km 310≤10 km 123>10 km 57

987 georeferenced · 353 without coordinates

Open the mapobservation + sensor1 340

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 28≤1 km 49≤10 km 54>10 km 28

159 georeferenced · 290 without coordinates

Open the institutions mapphysical evidence449

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	106
Universidad Nacional de Colombia (UNAL)location not on record	54
Natural History Museum of Utahlocation not on record	47
Universidad de los Llanos (UniLlanos)location not on record	44
UNICAMPlocation not on record	42
New Haven, US	39
Universidad de Antioquia (UdeA)location not on record	32
Cambridge, US	14
MZLUlocation not on record	14
Tapachula, MX	12
Universidad de Sucre (UniSucre)location not on record	8
Caja de Compensación Familiar - Comfenalco Antioquialocation not on record	5
San Diego, US	3
Natural History Museum Rotterdamlocation not on record	3
Brussels, BE	2
Tartu, EE	1
Smithsonian Tropical Research Institutelocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
Grupo Prodecolocation not on record	1
Auckland, NZ	1
Jardín Botánico Del Quindío (JBQ)location not on record	1
Chicago, US	1

23 institutions · 433 of 449 vouchered records shown · 16 without an institution code

09Environmental DNA162 detections

Where the DNA of Mechanitis polymnia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found162

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 162 detections have coordinates

Open the map5 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 16.8–26.2

Seasonal swing summer↔winter1.80 °C

Max temp (day)28.1 °C 20.5–29.3

Min temp (night)22.0 °C 12.9–23.0

Precipitation187 mm/mo 99.8–285

Air humidity69.4 % 63.5–72.0

Moisture balance64.7 mm/mo -11.8–158

Vapour deficit935 Pa 581–1,075

Wind speed0.7 m/s 0.5–2.10

Cloud cover57.9 % 28.4–83.5

CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mechanitis polymnia

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 832 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 832 records