Mechanitis mazaeus

Hewitson, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Mechanitis

At a glance

Occurrence records62

Data sources9

Biological traits0

DNA specimens176

eDNA detections122

Sources9 archives

Databases and archives Mechanitis mazaeus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI122 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics176 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF62 records

Environmental DNA1 datasets · 3 countries122 detections

DNA & barcodingBOLD176 specimens

Genome at a glanceGoaT · NCBI≈291 Mbp

01Narrative

Mechanitis mazaeus, the Mazaeus tigerwing, is a species of butterfly of the family Nymphalidae. It is found in South America. The larvae have been recorded feeding on Solanum species, including S. subnerme.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding176 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mechanitis mazaeus has left across the world's sequence archives.

At a glance

DNA specimens176

BINs5

Marker genes1

eDNA detections122

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P623 bp consensus99 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

39Avariable

48Avariable

51Tvariable

54Tmostly conserved

69Tmostly conserved

126Avariable

135Tvariable

168Tvariable

183Avariable

186Tvariable

201Cvariable

219Avariable

306Cmostly conserved

309Avariable

312Cmostly conserved

324Tvariable

330Cvariable

336Amostly conserved

342Tmostly conserved

366Cmostly conserved

367Tvariable

369Avariable

390Avariable

396Amostly conserved

405Tvariable

414Cvariable

462Amostly conserved

465Tmostly conserved

507Amostly conserved

531Gvariable

543Avariable

585Avariable

597Amostly conserved

600Tmostly conserved

603Tmostly conserved

609Tvariable

612Cvariable

ATAGTAGGAACATCTCTTAGTTTAATAATTCGAACTGAATTAGGAACACCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes31

BINs5

Most divergent pair4.7%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mechanitis lysimniasame genus1.6%Mechanitis polymniasame genus2.6%Mechanitis isthmiasame genus2.7%Mechanitis menapissame genus2.9%Greta otosame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mechanitis mazaeus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈290 701 178 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Mechanitis mazaeus0.29 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.5% BUSCO

08Occurrence & distribution

Record type62 records

Wild obs. + sensor32

Museum / vouchered30

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 10≤1 km 10≤10 km 1>10 km 6

27 georeferenced · 5 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤1 km 6≤10 km 10>10 km 3

19 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	7
Cambridge, US	5
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
Universidad de los Llanos (UniLlanos)location not on record	2
RBINS-Scientific Heritagelocation not on record	2
Brussels, BE	2
Tartu, EE	1
Natural History Museum of Utahlocation not on record	1
UNICAMPlocation not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Auckland, NZ	1
MZLUlocation not on record	1
Chicago, US	1

14 institutions · 30 of 30 vouchered records shown

09Environmental DNA122 detections

Where the DNA of Mechanitis mazaeus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found122

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 122 detections have coordinates

Open the map3 countries0

seasonal primary forest on laterite-bauxite …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.4–26.0

Seasonal swing summer↔winter2.10 °C

Max temp (day)28.1 °C 27.8–29.3

Min temp (night)22.3 °C 20.6–22.8

Precipitation277 mm/mo 128–277

Air humidity71.2 % 69.2–71.3

Moisture balance158 mm/mo 3.80–158

Vapour deficit910 Pa 901–991

Wind speed0.7 m/s 0.6–1.00

Cloud cover83.5 % 57.9–83.5

CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)