Mechanitis isthmia

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Mechanitis

At a glance

Occurrence records76

Data sources4

Biological traits0

DNA specimens205

eDNA detections230

Sources4 archives

Databases and archives Mechanitis isthmia's data was compiled from.

GBIFGlobal Biodiversity Information Facility76 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI230 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics205 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF76 records

Environmental DNA1 datasets · 5 countries230 detections

DNA & barcodingBOLD205 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding205 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mechanitis isthmia has left across the world's sequence archives.

At a glance

DNA specimens205

BINs3

Marker genes1

eDNA detections230

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus203 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

40Gmostly conserved

343Tmostly conserved

358Cvariable

370Amostly conserved

AACACTATATTTTATTTTCGGAATTTGAGCAGGAATAGTGGGAACATCTCTTAGTTTAATAATTCGAACTGAGTTAGGAACCCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.45%

Haplotypes17

BINs3

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mechanitis lysimniasame genus1.7%Mechanitis menapissame genus2.3%Mechanitis mazaeussame genus2.7%Episcada sylvosame family7.0%Episcada apuleiasame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type76 records

Museum / vouchered76

Range

Area of Occupancy AOO136 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤1 km 7≤10 km 4>10 km 1

12 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence76

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Musée des Confluenceslocation not on record	45
Cleveland Museum of Natural History, OH (CLEV)location not on record	14
Brussels, BE	6
RBINS-Scientific Heritagelocation not on record	3
University of Pennsylvanialocation not on record	2
Natural History Museum of Utahlocation not on record	2
Chicago, US	2
Caja de Compensación Familiar - Comfenalco Antioquialocation not on record	1
Cambridge, US	1

9 institutions · 76 of 76 vouchered records shown

09Environmental DNA230 detections

Where the DNA of Mechanitis isthmia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found230

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 230 detections have coordinates

Open the map5 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…Forest1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.4–27.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.4 °C 25.6–32.2

Min temp (night)21.9 °C 20.7–23.9

Precipitation288 mm/mo 58.6–468

Air humidity70.3 % 61.6–75.5

Moisture balance158 mm/mo -102–334

Vapour deficit927 Pa 717–1,424

Wind speed1.50 m/s 1.30–3.70

Cloud cover31.3 % 13.6–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 188 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)