Eriocrania sparrmannella

(Bosc, 1791) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Eriocraniidae/Eriocrania

At a glance

Occurrence records1 112

Data sources10

Biological traits2

DNA specimens21

eDNA detections149

Sources10 archives

Databases and archives Eriocrania sparrmannella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI149 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionNPASS10 compounds

Occurrence & distributionGBIF1 112 records

Environmental DNA3 datasets · 13 countries149 detections

DNA & barcodingBOLD21 specimens

Genome at a glanceGoaT · NCBI≈606 Mbp

01Narrative

Eriocrania sparrmannella also known as the mottled purple is a moth of the family Eriocraniidae, found in Europe and Japan. It was first described by the French entomologist, Louis Augustin Guillaume Bosc in 1791. The specific name honours the Swedish naturalist Anders Erikson Sparrman. The larvae mine the leaves of birch (Betula species).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

03Chemical composition10 compounds

Compounds documented for Eriocrania sparrmannella across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Chalcones7

Flavones2

Flavanones1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-5,7,8-trimethoxy-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
2',3',4',6'-Tetramethoxychalcone	present	NPASS
2'-Hydroxy-3',4',6'-trimethoxychalcone	present	NPASS
2-Propen-1-one, 3-phenyl-1-(2,3,4,6-tetramethoxyphenyl)-	present	NPASS
2-Propen-1-one,1-(2-hydroxy-3,4,6-trimethoxyphenyl)-3-phenyl-	present	NPASS
3-(4-Hydroxyphenyl)-1-(2-hydroxy-3,4,6-trimethoxyphenyl)prop-2-en-1-one	present	NPASS
4,2'-Dihydroxy-3',4',6'-trimethoxychalcone	present	NPASS
5,6,7-Trimethoxy-2-phenyl-4H-1-benzopyran-4-one	present	NPASS
Methylpedicin	present	NPASS
Mosloflavone	present	NPASS

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriocrania sparrmannella has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections149

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

34Amostly conserved

38Gmostly conserved

115Tmostly conserved

181Gmostly conserved

184Amostly conserved

206Cmostly conserved

208Tmostly conserved

212Tmostly conserved

217Amostly conserved

220Tmostly conserved

235Cvariable

250Cvariable

263Tmostly conserved

271Cmostly conserved

316Amostly conserved

337Amostly conserved

361Tmostly conserved

382Cvariable

385Cmostly conserved

415Amostly conserved

433Gmostly conserved

439Tmostly conserved

542Tmostly conserved

544Amostly conserved

562Tmostly conserved

586Amostly conserved

613Tmostly conserved

625Cvariable

628Amostly conserved

631Amostly conserved

646Cmostly conserved

652Cmostly conserved

653Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes9

BINs2

Most divergent pair3.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eriocrania salopiellasame genus7.3%Neocrania bifasciatasame family8.4%Eriocraniella xanthocarasame family8.6%Eriocraniella longifurculasame family8.7%Eriocraniella aurosparsellasame family8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Eriocrania sparrmannella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈605 702 979 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Eriocrania sparrmannella0.61 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness87.1% BUSCO

08Occurrence & distribution

Record type1 112 records

Wild obs. + sensor892

Museum / vouchered220

Range

Area of Occupancy AOO3 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 290≤1 km 276≤10 km 305>10 km 1

872 georeferenced · 20 without coordinates

Open the mapobservation + sensor892

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 76≤1 km 80≤10 km 30>10 km 5

191 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence220

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	42
NHMOlocation not on record	31
SLU Artdatabankenlocation not on record	19
DanishLepidopterologicalSocietylocation not on record	13
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	7
Tilburg, NL	6
South Kensington, GB	6
RMZlocation not on record	4
Provincia di Livornolocation not on record	4
Washington, US	4
Cambridge, US	3
Nijmegen, NL	3
Stockholm, SE	2
Rovaniemi, FI	2
NTNU-VMlocation not on record	2
Tartu, EE	2
Iwate Prefectural Museumlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Helgeland Museum, Natural History Departmentlocation not on record	2
Research Collection of Kai Berggrenlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Natural History Museum, Londonlocation not on record	1
neflocation not on record	1

24 institutions · 161 of 220 vouchered records shown · 58 without an institution code

09Environmental DNA149 detections

Where the DNA of Eriocrania sparrmannella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found149

Studies independent surveys3

Countries13

Verifiable raw sequence linked77

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 149 detections have coordinates

Open the map13 countries0

in oak-birch forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.00 °C 4.10–11.2

Seasonal swing summer↔winter19.8 °C

Max temp (day)11.2 °C 7.10–15.9

Min temp (night)3.10 °C -0.5–7.20

Precipitation54.4 mm/mo 36.9–97.6

Air humidity59.3 % 56.6–61.8

Moisture balance-26.8 mm/mo -56.9–26.4

Vapour deficit432 Pa 326–565

Wind speed3.00 m/s 2.30–4.40

Cloud cover44.7 % 39.0–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 147 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eriocrania sparrmannella

At a glance

Sources10 archives

Diet & foraging2

Compound class profile3 classes

Documented compounds10 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 112 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 112 records