Eriocraniella aurosparsella

(Walsingham, 1880) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Eriocraniidae/Eriocraniella

At a glance

Occurrence records15

Data sources7

Biological traits0

DNA specimens12

eDNA detections10

Sources7 archives

Databases and archives Eriocraniella aurosparsella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD12 specimens

01Narrative

Eriocraniella aurosparsella is a moth of the family Eriocraniidae. It was described by Walsingham in 1880. It is found from southern Oregon south through the coastal ranges of California to Santa Clara County and Santa Cruz Island.A Revision of the North American Moths of the Superfamily Eriocranioidea with the Proposal of a New Family, Acanthopteroctetidae (Lepidoptera) The wingspan is 8–9 mm for males and 7.5-8.5 mm for females. The forewings are immaculate, brownish fuscous, usually with a distinct bronzy to light purplish iridescence. The hindwings are similar to the forewings though less lustrous. They are uniformly covered with relatively broad scales. Adults are on wing from late February to late May in one generation per year. The larvae feed on Quercus kellogii. They mine the leaves of their host plant. The mine is elongate and linear at first. It follows the leaf margin for a short distance and then abruptly enlarges to form a large, full-depth blotch. The larvae have a dark brown body and a uniformly dark brown head.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriocraniella aurosparsella has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

26Amostly conserved

86Amostly conserved

200Amostly conserved

215Amostly conserved

260Gmostly conserved

269Tmostly conserved

345Tmostly conserved

440Tvariable

488Tmostly conserved

518Amostly conserved

563Amostly conserved

575Gmostly conserved

614Cmostly conserved

CTTTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCTGAATTAGGAAACCCTGGATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes4

BIN1

Most divergent pair0.92%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eriocraniella xanthocarasame genus3.5%Eriocraniella longifurculasame genus4.6%Eriocraniella trigonasame genus5.4%Dyseriocrania griseocapitellasame family8.3%Eriocrania salopiellasame family8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~58.9 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin58.9 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

08Occurrence & distribution

Record type15 records

Wild obs. + sensor2

Museum / vouchered13

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	8
Santa Cruz, US	3
New Haven, US	1
Colorado State Universitylocation not on record	1

4 institutions · 13 of 13 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Eriocraniella aurosparsella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 11.7–12.9

Seasonal swing summer↔winter19.3 °C

Max temp (day)20.1 °C 16.2–20.1

Min temp (night)5.70 °C 5.20–9.30

Precipitation28.3 mm/mo 28.3–95.7

Air humidity46.5 % 46.5–61.8

Moisture balance-131 mm/mo -131–-37.0

Vapour deficit804 Pa 520–804

Wind speed3.00 m/s 2.90–3.60

Cloud cover25.7 % 24.9–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)