Eriocraniella longifurcula

Davis, 1978 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Eriocraniidae/Eriocraniella

At a glance

Occurrence records46

Data sources7

Biological traits0

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Eriocraniella longifurcula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF46 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Eriocraniella longifurcula is a moth of the family Eriocraniidae. It was described by Davis in 1978.Catalogue of Life: 2009 Annual Checklist It is found in central Arizona.A Revision of the North American Moths of the Superfamily Eriocranioidea with the Proposal of a New Family, Acanthopteroctetidae (Lepidoptera) The wingspan is 9.5–10 mm for males. The forewings are relatively slender and immaculate, fuscous with a slight bluish purple iridescence. The hindwings are slightly paler than the forewings, grayish, uniformly covered with relatively broad scales. Adults are on wing in May, probably in one generation per year. The larvae possibly feed on Fagaceae species. They have a dark brown body and a uniformly light brown to stramineous head

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriocraniella longifurcula has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.35%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 3 variable positions, in barcode order

166Avariable

427Tvariable

562Avariable

AACTTTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eriocraniella trigonasame genus3.3%Eriocraniella aurosparsellasame genus4.6%Eriocraniella xanthocarasame genus4.6%Dyseriocrania auricyaneasame family8.0%Eriocrania semipurpurellasame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type46 records

Museum / vouchered46

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤1 km 22≤10 km 1

23 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence46

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	22
Washington, US	21
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Colorado State Universitylocation not on record	1

4 institutions · 46 of 46 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Eriocraniella longifurcula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.2 °C

Max temp (day)22.2 °C

Min temp (night)7.90 °C

Precipitation18.4 mm/mo

Air humidity40.6 %

Moisture balance-139 mm/mo

Vapour deficit1,034 Pa

Wind speed2.30 m/s

Cloud cover33.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)