Eriocraniella xanthocara

Davis, 1978 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Eriocraniidae/Eriocraniella

At a glance

Occurrence records14

Data sources7

Biological traits0

DNA specimens13

eDNA detections14

Sources7 archives

Databases and archives Eriocraniella xanthocara's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD13 specimens

01Narrative

Eriocraniella xanthocara is a moth of the family Eriocraniidae. It was described by Davis in 1978.Catalogue of Life: 2009 Annual Checklist It is found in California.A Revision of the North American Moths of the Superfamily Eriocranioidea with the Proposal of a New Family, Acanthopteroctetidae (Lepidoptera) The wingspan is 7–8 mm for males and 7.5-8.5 mm for females. The forewings are immaculate, dark fuscous with a prominent greenish blue iridescence. The hindwings are similar to the forewings in color though less lustrous and with more purplish iridescence. They are uniformly covered with relatively broad scales. Adults are on wing from early March to late April in one generation per year. The larvae feed on Quercus agrifolia and Quercus wislizenii. They mine the leaves of their host plant. They have a brownish body and a uniformly light brown to stramineous head

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriocraniella xanthocara has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections14

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

28Tmostly conserved

47Tmostly conserved

76Amostly conserved

79Tmostly conserved

85Avariable

97Tmostly conserved

124Amostly conserved

127Amostly conserved

187Amostly conserved

199Amostly conserved

217Tmostly conserved

232Tmostly conserved

235Tmostly conserved

239Cmostly conserved

241Tmostly conserved

250Gmostly conserved

260Tmostly conserved

268Tmostly conserved

271Tmostly conserved

274Tmostly conserved

298Amostly conserved

313Amostly conserved

322Amostly conserved

334Amostly conserved

337Cmostly conserved

340Amostly conserved

361Avariable

379Amostly conserved

397Tmostly conserved

409Tvariable

412Amostly conserved

442Tmostly conserved

496Tmostly conserved

497Tvariable

526Cvariable

544Cmostly conserved

550Amostly conserved

553Amostly conserved

583Amostly conserved

589Tmostly conserved

601Tmostly conserved

607Cmostly conserved

613Tmostly conserved

619Amostly conserved

622Gmostly conserved

628Avariable

TTTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCTGAATTAGGAAATCCTGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes9

BINs2

Most divergent pair6.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eriocraniella aurosparsellasame genus3.5%Eriocraniella longifurculasame genus4.6%Eriocraniella trigonasame genus5.4%Paracrania chrysolepidellasame family7.5%Dyseriocrania auricyaneasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type14 records

Museum / vouchered14

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence14

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	11
Essig Museum of Entomologylocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

3 institutions · 14 of 14 vouchered records shown

09Environmental DNA14 detections

Where the DNA of Eriocraniella xanthocara was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 9.30–16.5

Seasonal swing summer↔winter14.6 °C

Max temp (day)17.4 °C 14.0–23.5

Min temp (night)8.30 °C 4.20–9.70

Precipitation63.0 mm/mo 41.7–104

Air humidity55.4 % 51.6–61.8

Moisture balance-64.6 mm/mo -76.1–36.6

Vapour deficit630 Pa 473–897

Wind speed2.10 m/s 1.70–3.40

Cloud cover44.0 % 32.7–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)