Eriocrania salopiella

Stainton, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Eriocraniidae/Eriocrania

At a glance

Occurrence records367

Data sources7

Biological traits2

DNA specimens10

eDNA detections19

Sources7 archives

Databases and archives Eriocrania salopiella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility367 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF367 records

Environmental DNA2 datasets · 6 countries19 detections

DNA & barcodingBOLD10 specimens

01Narrative

Eriocrania salopiella (also known as the small birch purple) is a moth of the family Eriocraniidae and is found in Europe. It was described by the English entomologist, Henry Tibbats Stainton in 1854. The larvae mine the leaves of birch (Betula species).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriocrania salopiella has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections19

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

34Amostly conserved

50Tmostly conserved

88Cmostly conserved

100Gmostly conserved

118Tmostly conserved

133Tmostly conserved

146Amostly conserved

149Amostly conserved

178Cvariable

181Gvariable

200Amostly conserved

202Cmostly conserved

216Gmostly conserved

217Amostly conserved

218Gmostly conserved

219Cmostly conserved

220Tmostly conserved

242Cmostly conserved

271Cmostly conserved

274Amostly conserved

280Amostly conserved

283Tmostly conserved

287Cmostly conserved

346Tmostly conserved

349Amostly conserved

364Gvariable

385Cmostly conserved

419Tmostly conserved

433Amostly conserved

465Tmostly conserved

490Tmostly conserved

499Tmostly conserved

518Gmostly conserved

546Cmostly conserved

565Gmostly conserved

586Gmostly conserved

634Cmostly conserved

658Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCATTAAGAATTTTAATTCGATCTGAATTAGGAAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eriocrania sparrmannellasame genus7.3%Eriocraniella xanthocarasame family8.4%Eriocraniella aurosparsellasame family8.6%Dyseriocrania auricyaneasame family9.0%Dyseriocrania griseocapitellasame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type367 records

Wild obs. + sensor311

Museum / vouchered56

Range

Area of Occupancy AOO1 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 80≤1 km 97≤10 km 128

305 georeferenced · 6 without coordinates

Open the mapobservation + sensor311

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 26≤1 km 14≤10 km 9

49 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	10
South Kensington, GB	5
Tartu, EE	4
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	4
Natural History Museum, Londonlocation not on record	4
DanishLepidopterologicalSocietylocation not on record	3
Rovaniemi, FI	2
SLU Artdatabankenlocation not on record	2
Stockholm, SE	1
NTNU-VMlocation not on record	1
Tilburg, NL	1

11 institutions · 37 of 56 vouchered records shown · 19 without an institution code

09Environmental DNA19 detections

Where the DNA of Eriocrania salopiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys2

Countries6

Verifiable raw sequence linked9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 5.60–12.9

Seasonal swing summer↔winter20.2 °C

Max temp (day)13.7 °C 9.60–16.6

Min temp (night)4.80 °C 0.9–8.20

Precipitation52.2 mm/mo 47.1–103

Air humidity59.2 % 56.0–60.1

Moisture balance-33.3 mm/mo -53.5–9.70

Vapour deficit508 Pa 364–632

Wind speed3.00 m/s 2.20–4.20

Cloud cover47.7 % 37.7–53.6

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)