Argyrotaenia niscana

(Kearfott, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records117

Data sources8

Biological traits0

DNA specimens38

eDNA detections49

Sources8 archives

Databases and archives Argyrotaenia niscana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility117 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF117 records

Environmental DNA1 datasets · 2 countries49 detections

DNA & barcodingBOLD38 specimens

01Narrative

Argyrotaenia niscana is a species of moth of the family Tortricidae. It is found in the United States, where it has been recorded from California and Mississippi.mothphotographersgroup The wingspan is about 14–16 mm. Adults have been recorded on wing from March to June, in August and in October. The larvae feed on Adenostoma species, including Adenostoma fasciculatum.Brown, J. W., G. Robinson & J. A. Powell. 2008. Food plant database of the leafrollers of the world (Lepidoptera: Tortricidae) (Version 1.0)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia niscana has left across the world's sequence archives.

At a glance

DNA specimens38

BINs1

Marker genes2

eDNA detections49

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

19Cmostly conserved

20Gmostly conserved

85Amostly conserved

157Cmostly conserved

271Cmostly conserved

340Cmostly conserved

625Cmostly conserved

628Gmostly conserved

646Cmostly conserved

TACATTATATTTCATTTTCGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes12

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia franciscanasame genus6.5%Argyrotaenia sphaleropasame genus7.3%Archips betulanasame family8.1%Argyrotaenia klotsisame genus8.1%Ericodesma isochroasame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type117 records

Wild obs. + sensor14

Museum / vouchered103

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 5≤10 km 1

6 georeferenced · 8 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy1% within 1 km

≤100 m 1≤10 km 78>10 km 15

94 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	87
Mississippi State, US	7
New Haven, US	6
San Francisco, US	1
Centre for Biodiversity Genomicslocation not on record	1

5 institutions · 102 of 103 vouchered records shown · 1 without an institution code

09Environmental DNA49 detections

Where the DNA of Argyrotaenia niscana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map2 countries0

PinesMarsh

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 14.4–21.7

Seasonal swing summer↔winter15.8 °C

Max temp (day)29.9 °C 16.2–30.2

Min temp (night)14.2 °C 11.5–16.0

Precipitation2.70 mm/mo 2.40–21.9

Air humidity45.3 % 41.1–63.9

Moisture balance-163 mm/mo -213–-99.7

Vapour deficit1,400 Pa 620–1,534

Wind speed1.90 m/s 1.60–4.40

Cloud cover19.5 % 14.9–31.0

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)