Argyrotaenia klotsi

Obraztsov, 1961 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records27

Data sources7

Biological traits0

DNA specimens13

eDNA detections11

Sources7 archives

Databases and archives Argyrotaenia klotsi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD13 specimens

01Narrative

Argyrotaenia klotsi is a species of moth of the family Tortricidae. It is found in the United States, where it has been recorded from Arizona, New Mexico and California.mothphotographersgroup The length of the forewings is 8-9.5 mm. The ground color of the forewings is pale ocherous, but somewhat brownish salmon dorsad and pale silvery gray externad. The basal area is dark grey, mottled and outlined with darker grey. The hindwings are fuscous white., 1961: Descriptions of and Notes on North and Central American Species of Argyrotaenia, with the description of a new Genus (Lepidoptera: Tortricidae). American Museum Novitates 2048: 1-42. Full article: [1]. Adults have been recorded on wing from July to August.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia klotsi has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

115Cmostly conserved

433Amostly conserved

TACATTATATTTTATTTTCGGAATTTGAGCTGGTATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.06%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia lautanasame genus5.5%Argyrotaenia coconinanasame genus5.8%Argyrotaenia dorsalanasame genus5.9%Clepsis abscisanasame family6.3%Choristoneura simonyisame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type27 records

Wild obs. + sensor5

Museum / vouchered22

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	16
San Francisco, US	2
Cornell University Insect Collectionlocation not on record	2
Vernal, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

5 institutions · 22 of 22 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Argyrotaenia klotsi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 11.2–17.6

Seasonal swing summer↔winter23.7 °C

Max temp (day)23.4 °C 18.8–23.5

Min temp (night)7.60 °C 4.20–12.1

Precipitation89.0 mm/mo 33.7–119

Air humidity50.2 % 44.2–53.6

Moisture balance-51.4 mm/mo -131–-30.7

Vapour deficit936 Pa 673–992

Wind speed2.10 m/s 1.90–2.10

Cloud cover23.5 % 22.0–29.3

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)