Argyrotaenia dorsalana

(Dyar, 1903) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records140

Data sources8

Biological traits0

DNA specimens59

eDNA detections83

Sources8 archives

Databases and archives Argyrotaenia dorsalana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI83 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics59 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF140 records

Environmental DNA1 datasets · 2 countries83 detections

DNA & barcodingBOLD59 specimens

01Narrative

Argyrotaenia dorsalana is a moth of the family Tortricidae. It is found in North America from British Columbia and Washington, south to California and Utah. The wingspan is 16–22 mm. The larvae mainly feed on Douglas-fir, Rocky Mountain Douglas-fir, western hemlock and western larch, but have also been recorded on grand fir, ponderosa pine and spruce. It appears to overwinter in the egg stage. Larvae are present from early May to mid-June. Pupation takes place in late June and adults emerge soon after.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding59 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia dorsalana has left across the world's sequence archives.

At a glance

DNA specimens59

BINs1

Marker genes1

eDNA detections83

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus59 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

19Cmostly conserved

TACATTATATTTTATTTTCGGAATTTGAGCAGGTATAGTAGGAACATCATTAAGATTACTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes8

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia lautanasame genus3.0%Argyrotaenia burroughsisame genus5.6%Argyrotaenia klotsisame genus5.9%Argyrotaenia coconinanasame genus6.5%Pandemis coniferanasame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type140 records

Wild obs. + sensor45

Museum / vouchered95

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 27≤1 km 3≤10 km 3>10 km 2

35 georeferenced · 10 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 2≤10 km 8>10 km 3

13 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	49
University of California, Davislocation not on record	9
ASUlocation not on record	7
St. Paul, US	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Philadelphia, US	3
Mississippi State, US	2
Essig Museum of Entomologylocation not on record	2
Colorado State Universitylocation not on record	1

9 institutions · 83 of 95 vouchered records shown · 12 without an institution code

09Environmental DNA83 detections

Where the DNA of Argyrotaenia dorsalana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found83

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 83 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate ForestForest5. Wetlands (inland)4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 13.7–21.0

Seasonal swing summer↔winter24.9 °C

Max temp (day)25.7 °C 17.5–28.1

Min temp (night)11.3 °C 9.60–14.2

Precipitation36.4 mm/mo 28.7–45.6

Air humidity51.0 % 44.4–59.6

Moisture balance-94.3 mm/mo -122–-87.7

Vapour deficit1,129 Pa 632–1,231

Wind speed2.50 m/s 2.10–3.60

Cloud cover35.2 % 29.5–39.1

CHELSA 1981–2010, ~9 km grid, at location & month of 82 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)