Argyrotaenia sphaleropa

(Meyrick, 1909) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records78

Data sources8

Biological traits0

DNA specimens16

eDNA detections13

Sources8 archives

Databases and archives Argyrotaenia sphaleropa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD16 specimens

01Narrative

Argyrotaenia sphaleropa is a species of moth of the family Tortricidae. It is found in South America, where it has been recorded from Colombia, Bolivia, Brazil, Peru, Uruguay and Argentina.SATA The wingspan is about 15 mm for females and about 12 mm for males. The larvae feed on Baccharis salicifolia, Citrus species, Cosmos species, Diospyros kaki, Medicago sativa, Mimosa diplotricha, Mentha sauveolens, Persea species, Hibiscus rosa-sinensis, Rapanea umbellata, Rosa species, Solanum bonariense, Lantana camara, Vitis species (including Vitis vinifera) and Mikania cordifolia.Brown, J. W., G. Robinson & J. A. Powell. 2008. Food plant database of the leafrollers of the world (Lepidoptera: Tortricidae) (Version 1.0) The larvae are considered a pest, causing damage to leaves and reproductive structures of numerous fruits, herbaceous and ornamental plant species.Argyrotaenia sphaleropa (Meyrick) (Lepidoptera: Tortricidae) in Citrus in the State of Paraná, Brazil

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia sphaleropa has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P669 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

25Tmostly conserved

46Amostly conserved

58Amostly conserved

103Cmostly conserved

160Amostly conserved

226Tmostly conserved

235Cvariable

385Tmostly conserved

400Tmostly conserved

421Cmostly conserved

427Cmostly conserved

451Gmostly conserved

562Gmostly conserved

616Tmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGTACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes6

BINs2

Most divergent pair1.9%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adoxophyes trirhabdasame family7.0%Argyrotaenia niscanasame genus7.3%Adoxophyes panxanthasame family7.6%Argyrotaenia lautanasame genus7.6%Argyrotaenia franciscanasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type78 records

Wild obs. + sensor70

Museum / vouchered8

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 24≤1 km 19≤10 km 8>10 km 1

52 georeferenced · 18 without coordinates

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
PUC-RSlocation not on record	7

1 institutions · 7 of 8 vouchered records shown · 1 without an institution code

09Environmental DNA13 detections

Where the DNA of Argyrotaenia sphaleropa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter10.7 °C

Max temp (day)30.1 °C

Min temp (night)20.2 °C

Precipitation159 mm/mo

Air humidity60.0 %

Moisture balance-19.4 mm/mo

Vapour deficit1,277 Pa

Wind speed1.70 m/s

Cloud cover44.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)