Argyrotaenia franciscana

(Walsingham, 1879) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records362

Data sources8

Biological traits0

DNA specimens164

eDNA detections185

Sources8 archives

Databases and archives Argyrotaenia franciscana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility362 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI185 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics164 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF362 records

Environmental DNA1 datasets · 2 countries185 detections

DNA & barcodingBOLD164 specimens

01Narrative

Argyrotaenia franciscana, the orange tortrix or apple skinworm, is a moth of the family Tortricidae. It is found from California north to Oregon and Washington.Factsheet - Argyrotaenia franciscana The length of the forewings is 5.6-9.9 mm. There are at least two, but sometimes more generations per year. The larvae feed on a wide range of nearly 80 plants, including Malus, Prunus armeniaca, Persea americana, Rubus, Vaccinium, Vitis, Citrus x paradisi, Citrus limon and Pinus radiata. Early instar larvae skeletonize leaves under a silk shelter, while later instars roll, fold, or web leaves together or to fruits. Either the larvae or pupae overwinter. Overwintering can take place in dead leaves, mummified fruits, under buds or on weedy herbaceous plants near the host. Pupation occurs in the final larval shelter.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding164 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia franciscana has left across the world's sequence archives.

At a glance

DNA specimens164

BINs2

Marker genes1

eDNA detections185

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus141 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

34Tmostly conserved

79Avariable

97Tvariable

106Cvariable

250Tvariable

316Avariable

364Tvariable

367Tvariable

400Cvariable

403Gvariable

424Gvariable

457Cvariable

511Amostly conserved

523Cvariable

548Cvariable

577Amostly conserved

628Avariable

634Cmostly conserved

646Tvariable

652Tvariable

TACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTCTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes21

BINs2

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia niscanasame genus6.5%Argyrotaenia klotsisame genus7.4%Clepsis abscisanasame family7.5%Choristoneura diversanasame family7.6%Argyrotaenia sphaleropasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type362 records

Wild obs. + sensor192

Museum / vouchered170

Origin

Native5

Range

Area of Occupancy AOO648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 101≤1 km 23≤10 km 7>10 km 19

150 georeferenced · 42 without coordinates

Open the mapobservation + sensor192

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 15≤1 km 63≤10 km 26>10 km 12

116 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence170

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Essig Museum of Entomologylocation not on record	70
San Diego, US	21
New Haven, US	17
St. Paul, US	15
Mississippi State, US	8
Cornell University Insect Collectionlocation not on record	7
San Francisco, US	5
Los Angeles, US	5
Vernal, US	4
King Saud Universitylocation not on record	3
ASUlocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
IAWlocation not on record	2
US	1
Washington State Department of Agriculturelocation not on record	1
East Lansing, US	1

16 institutions · 165 of 170 vouchered records shown · 5 without an institution code

09Environmental DNA185 detections

Where the DNA of Argyrotaenia franciscana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found185

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 185 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandSaltmarsh/CSSMarshUrbanPinesWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 11.7–18.3

Seasonal swing summer↔winter7.40 °C

Max temp (day)18.4 °C 15.2–21.9

Min temp (night)11.8 °C 8.20–16.0

Precipitation37.0 mm/mo 2.10–80.2

Air humidity62.2 % 59.7–67.0

Moisture balance-53.6 mm/mo

Vapour deficit599 Pa 471–750

Wind speed3.30 m/s

Cloud cover33.9 % 16.0–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 138 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)