Archips betulana

(Hübner, 1787) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records268

Data sources7

Biological traits0

DNA specimens5

eDNA detections12

Sources7 archives

Databases and archives Archips betulana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility268 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF268 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD5 specimens

01Narrative

Archips betulana is a moth of the family Tortricidae. It is found from Fennoscandia south to Italy, Austria and Slovakia and from the Netherlands and Belgium east to southern Russia and the eastern part of the Palearctic realm. It is extinct in Great Britain, where it was only known from damp heathland in the neighbourhood of King's Lynn in Norfolk. It was first recorded in around 1881 and was last seen around 1900. Its wingspan is 18–28 mm and it can be found in August hiding amongst foliage. The larvae feed between spun leaves, on birch (Betula species), Hazel (Corylus species), bog-myrtle (Myrica gale) and bilberry (Vaccinium myrtillus). The larvae can be found from May to June.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips betulana has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections12

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)3.8%

Haplotypes2

BINs2

Most divergent pair7.6%

Where individuals differ — all 50 variable positions, in barcode order

1Amostly conserved

34Amostly conserved

49Tmostly conserved

59Tmostly conserved

85Amostly conserved

91Tmostly conserved

97Tmostly conserved

100Tmostly conserved

118Tmostly conserved

121Cmostly conserved

127Amostly conserved

133Tmostly conserved

157Tmostly conserved

163Tmostly conserved

169Amostly conserved

172Tmostly conserved

178Tmostly conserved

202Tmostly conserved

206Cmostly conserved

214Gmostly conserved

235Tmostly conserved

238Tmostly conserved

274Cmostly conserved

284Tmostly conserved

286Amostly conserved

287Cmostly conserved

370Amostly conserved

376Cmostly conserved

386Cmostly conserved

397Cmostly conserved

400Cmostly conserved

401Cmostly conserved

421Amostly conserved

424Amostly conserved

436Tmostly conserved

482Amostly conserved

490Tmostly conserved

499Tmostly conserved

530Cmostly conserved

532Tmostly conserved

533Tmostly conserved

539Cmostly conserved

547Amostly conserved

562Amostly conserved

574Amostly conserved

581Cmostly conserved

619Amostly conserved

622Amostly conserved

634Tmostly conserved

637Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips podanasame genus2.1%Archips dissitanasame genus5.5%Homona mermerodessame family5.6%Aphelia peramplanasame family5.6%Aphelia albocilianasame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type268 records

Wild obs. + sensor183

Museum / vouchered84

Other1

Range

Area of Occupancy AOO624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 53≤1 km 40≤10 km 78>10 km 3

174 georeferenced · 9 without coordinates

Open the mapobservation + sensor183

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 22≤1 km 37≤10 km 21

80 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	56
Tartu, EE	13
SLU Artdatabankenlocation not on record	8
Provincia di Livornolocation not on record	1
Philadelphia, US	1
Kuopio, FI	1
Research Collection of Hartmut Wegnerlocation not on record	1

7 institutions · 81 of 84 vouchered records shown · 3 without an institution code

09Environmental DNA12 detections

Where the DNA of Archips betulana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 7.40–16.7

Seasonal swing summer↔winter23.2 °C

Max temp (day)16.8 °C 9.00–20.3

Min temp (night)9.80 °C 5.60–12.9

Precipitation60.5 mm/mo 57.2–74.0

Air humidity59.6 % 58.8–63.5

Moisture balance-49.4 mm/mo

Vapour deficit655 Pa 435–779

Wind speed4.60 m/s

Cloud cover42.9 % 41.4–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)