Archips dissitana

(Grote, 1879) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records1 042

Data sources7

Biological traits0

DNA specimens21

eDNA detections22

Sources7 archives

Databases and archives Archips dissitana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 042 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 042 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD21 specimens

01Narrative

Archips dissitana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1879 door Grote.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips dissitana has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

1Amostly conserved

5Amostly conserved

56Tmostly conserved

59Cmostly conserved

79Amostly conserved

400Amostly conserved

407Tmostly conserved

541Gvariable

571Tvariable

577Amostly conserved

637Tmostly conserved

AACAATATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes4

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips tsuganussame genus1.7%Archips striatanasame genus1.8%Archips strianussame genus2.0%Archips albertasame genus2.0%Archips packardianasame genus2.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 042 records

Wild obs. + sensor979

Museum / vouchered63

Range

Area of Occupancy AOO2 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 533≤1 km 154≤10 km 36>10 km 59

782 georeferenced · 197 without coordinates

Open the mapobservation + sensor979

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 1≤1 km 13≤10 km 18>10 km 4

36 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	32
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Cornell University Insect Collectionlocation not on record	5
New Haven, US	4
Mississippi State, US	3
Philadelphia, US	2
Cambridge, US	2
San Francisco, US	1
St. Paul, US	1

9 institutions · 55 of 63 vouchered records shown · 8 without an institution code

09Environmental DNA22 detections

Where the DNA of Archips dissitana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

UrbanTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 11.0–21.2

Seasonal swing summer↔winter30.5 °C

Max temp (day)25.1 °C 14.9–25.8

Min temp (night)16.0 °C 8.60–17.1

Precipitation106 mm/mo 91.1–163

Air humidity59.5 % 57.6–64.8

Moisture balance-26.6 mm/mo -48.1–25.0

Vapour deficit910 Pa 498–1,041

Wind speed3.20 m/s 1.10–3.30

Cloud cover44.4 % 28.6–53.1

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archips dissitana

At a glance

Sources7 archives

At a glance

Record type1 042 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 042 records