Archips alberta

(McDunnough, 1923) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records317

Data sources8

Biological traits0

DNA specimens16

eDNA detections1

Sources8 archives

Databases and archives Archips alberta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility317 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF317 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD16 specimens

01Narrative

Archips alberta is a species of moth of the family Tortricidae first described by James Halliday McDunnough in 1923.tortricidae.com It is found in North America, where it has been recorded across boreal Canada, south through the mountains to Utah. The habitat consists of coniferous forests. The wingspan is 22–25 mm.mothphotographersgroup The forewings are light grey to pinkish grey with thin dark lines and brown to grey bands that are edged by black lines. The hindwings are yellowish with darker grey reticulations. Adults are on wing from early July to mid-August. The larvae feed on Picea mariana, Picea glauca and Picea engelmannii. Young larvae mine needles and web adjacent needles together. Older larvae feed on foliage and cones. The larvae are greyish green to cream with a black head. The species overwinters as a first instar larva. Pupation takes place in a web.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips alberta has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes2

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

20Gmostly conserved

60Tmostly conserved

73Amostly conserved

79Amostly conserved

81Amostly conserved

82Tmostly conserved

200Amostly conserved

400Tmostly conserved

433Amostly conserved

463Tmostly conserved

466Amostly conserved

484Gmostly conserved

508Cmostly conserved

520Gmostly conserved

542Tmostly conserved

562Gmostly conserved

571Tmostly conserved

577Amostly conserved

625Gvariable

640Cmostly conserved

646Cmostly conserved

AACAATATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes6

BINs2

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips dissitanasame genus2.0%Archips strianussame genus2.4%Archips striatanasame genus3.2%Archips betulanasame genus6.4%Aphelia stigmatanasame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type317 records

Wild obs. + sensor256

Museum / vouchered61

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 168≤1 km 29≤10 km 8>10 km 2

207 georeferenced · 49 without coordinates

Open the mapobservation + sensor256

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 2≤1 km 19≤10 km 4>10 km 2

27 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	20
St. Paul, US	13
University of Alberta Museums (UAM)location not on record	12
Cornell University Insect Collectionlocation not on record	4
Royal Saskatchewan Museumlocation not on record	4
Cambridge, US	3
New Haven, US	2
Edmonton, CA	2

8 institutions · 60 of 61 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Archips alberta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)