Archips strianus

Fernald, 1905 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records579

Data sources8

Biological traits0

DNA specimens31

eDNA detections30

Sources8 archives

Databases and archives Archips strianus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility579 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF579 records

Environmental DNA1 datasets · 1 countries30 detections

DNA & barcodingBOLD31 specimens

01Narrative

Archips strianus, the striated tortrix moth or striated leafroller, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, British Columbia, Maine, Michigan, Minnesota, Montana, New Brunswick, Newfoundland, Ontario and Quebec.mothphotographersgroup The wingspan is about 20 mm. Adults have been recorded on wing from May to August. Abies balsamea, Pinus engelmannii and Picea species (including Picea glauca, Picea mariana, Picea pungens and Picea sitchensis).HOSTS - a Database of the World's Lepidopteran Hostplants

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips strianus has left across the world's sequence archives.

At a glance

DNA specimens31

BINs3

Marker genes1

eDNA detections30

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

38Gmostly conserved

59Amostly conserved

73Gmostly conserved

98Gmostly conserved

118Cmostly conserved

143Amostly conserved

202Tmostly conserved

214Amostly conserved

235Cvariable

280Tmostly conserved

281Amostly conserved

295Gmostly conserved

304Tmostly conserved

385Cmostly conserved

469Avariable

520Amostly conserved

523Cmostly conserved

577Amostly conserved

620Gmostly conserved

640Tmostly conserved

AACAATATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGATTAATAATTCGAGCTGAGTTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes8

BINs3

Most divergent pair3.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips dissitanasame genus2.0%Archips tsuganussame genus2.4%Archips albertasame genus2.4%Archips packardianasame genus2.4%Archips striatanasame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type579 records

Wild obs. + sensor496

Museum / vouchered83

Range

Area of Occupancy AOO1 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 356≤1 km 45≤10 km 20>10 km 24

445 georeferenced · 51 without coordinates

Open the mapobservation + sensor496

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 1≤1 km 14≤10 km 5>10 km 1

21 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	19
East Lansing, US	18
University of Guelph, Centre for Biodiversity Genomicslocation not on record	13
St. Paul, US	10
New Haven, US	2
Cambridge, US	1
San Francisco, US	1
Mississippi State, US	1

8 institutions · 65 of 83 vouchered records shown · 18 without an institution code

09Environmental DNA30 detections

Where the DNA of Archips strianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map1 country0

Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 15.4–19.0

Seasonal swing summer↔winter24.4 °C

Max temp (day)20.7 °C 19.2–23.7

Min temp (night)13.4 °C 11.6–14.3

Precipitation102 mm/mo 73.5–113

Air humidity61.3 % 56.7–64.0

Moisture balance-42.1 mm/mo -64.6–-16.7

Vapour deficit711 Pa 657–948

Wind speed3.50 m/s 2.50–5.20

Cloud cover50.3 % 39.9–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)