Archips packardiana

(Fernald, 1886) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records519

Data sources7

Biological traits0

DNA specimens53

eDNA detections1

Sources7 archives

Databases and archives Archips packardiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility519 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF519 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD53 specimens

01Narrative

Archips packardiana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1890 door Fernald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips packardiana has left across the world's sequence archives.

At a glance

DNA specimens53

BINs1

Marker genes2

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

200Amostly conserved

478Tmostly conserved

484Gmostly conserved

520Gmostly conserved

625Gmostly conserved

AACAATATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes10

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips dissitanasame genus2.0%Archips strianussame genus2.4%Archips striatanasame genus3.2%Archips betulanasame genus6.4%Aphelia stigmatanasame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type519 records

Wild obs. + sensor402

Museum / vouchered117

Range

Area of Occupancy AOO1 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 297≤1 km 36≤10 km 9>10 km 13

355 georeferenced · 47 without coordinates

Open the mapobservation + sensor402

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 2≤10 km 2>10 km 1

6 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	28
Royal Saskatchewan Museumlocation not on record	23
St. Paul, US	16
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Cornell University Insect Collectionlocation not on record	3
East Lansing, US	3
Cambridge, US	1
New Haven, US	1
Mississippi State, US	1
University of Guelphlocation not on record	1
Colorado State Universitylocation not on record	1
Essig Museum of Entomologylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

13 institutions · 89 of 117 vouchered records shown · 28 without an institution code

09Environmental DNA1 detections

Where the DNA of Archips packardiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)