Archips podana

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records45 084

Data sources8

Biological traits2

DNA specimens98

eDNA detections131

Sources8 archives

Databases and archives Archips podana's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 084 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI131 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics98 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF45 084 records

Environmental DNA3 datasets · 17 countries131 detections

DNA & barcodingBOLD98 specimens

01Narrative

Archips podana, the large fruit-tree tortrix, is a moth of the family Tortricidae. The species was first described by Giovanni Antonio Scopoli in his 1763 Entomologia Carniolica. It is found in Europe, Asia from Anatolia to Japan and is an introduced species in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding98 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips podana has left across the world's sequence archives.

At a glance

DNA specimens98

BINs1

Marker genes1

eDNA detections131

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus94 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

19Cmostly conserved

82Cmostly conserved

235Tmostly conserved

400Cmostly conserved

406Cmostly conserved

482Amostly conserved

562Gmostly conserved

619Gmostly conserved

622Amostly conserved

AACATTATATTTTATTTTCGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes13

BIN1

Most divergent pair1.8%

EuropeOtherN.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips betulanasame genus2.1%Aphelia albocilianasame family6.4%Choristoneura parallelasame family6.7%Cenopis reticulatanasame family6.8%Choristoneura simonyisame family6.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type45 084 records

Wild obs. + sensor42 107

Museum / vouchered2 740

Other237

Origin

Native252

Range

Area of Occupancy AOO32 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 11 154≤1 km 4 007≤10 km 23 045>10 km 113

38 319 georeferenced · 3 788 without coordinates

Open the mapobservation + sensor42 107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 1 423≤1 km 533≤10 km 296>10 km 2

2 254 georeferenced · 486 without coordinates

Open the institutions mapphysical evidence2 740

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	1 304
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	224
Provincia di Livornolocation not on record	218
NHMOlocation not on record	132
Tartu, EE	98
SLU Artdatabankenlocation not on record	71
Salzburg, AT	59
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	49
Nijmegen, NL	43
NTNU-VMlocation not on record	41
Philadelphia, US	40
Kuopio, FI	38
Muzeum Górnośląskie w Bytomiulocation not on record	34
Stockholm, SE	33
Natural History Museum Rotterdamlocation not on record	32
DABUHlocation not on record	24
Tallinn, EE	13
Zürich, CH	12
CBDClocation not on record	11
European Distributed Institute of Taxonomy (EDIT)location not on record	5
Brussels, BE	4
BioFokuslocation not on record	4
Metsähallituslocation not on record	4
South Kensington, GB	3
Radicondoli, IT	3
MZLUlocation not on record	3
University of Kaiserslauternlocation not on record	2
NMBU:MINAlocation not on record	2
neflocation not on record	2
NTNU University Museum, Department of Natural Historylocation not on record	2
ZSMlocation not on record	1
Mississippi State, US	1
Rovaniemi, FI	1
Ugentlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
University of Ostravalocation not on record	1
Uniwersytet Łódzkilocation not on record	1

37 institutions · 2 517 of 2 740 vouchered records shown · 223 without an institution code

09Environmental DNA131 detections

Where the DNA of Archips podana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found131

Studies independent surveys3

Countries17

Verifiable raw sequence linked25

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 131 detections have coordinates

Open the map17 countries0

1.1. Boreal Forest|1. Forest & WoodlandmeadowsJuniperus forestmixed forest allee43lowland deciduous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 12.4–18.9

Seasonal swing summer↔winter17.1 °C

Max temp (day)20.1 °C 16.0–23.3

Min temp (night)12.1 °C 8.30–14.6

Precipitation67.8 mm/mo 45.6–113

Air humidity59.4 % 57.2–62.3

Moisture balance-40.8 mm/mo -82.8–17.2

Vapour deficit755 Pa 571–984

Wind speed3.00 m/s 1.70–4.90

Cloud cover39.7 % 33.2–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archips podana

At a glance

Sources8 archives

Diet & foraging2

At a glance

Record type45 084 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type45 084 records