Argyresthia thuiella

Packard, 1871 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records518

Data sources7

Biological traits0

DNA specimens56

eDNA detections52

Sources7 archives

Databases and archives Argyresthia thuiella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility518 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF518 records

Environmental DNA1 datasets · 4 countries52 detections

DNA & barcodingBOLD56 specimens

01Narrative

Argyresthia thuiella, the arborvitae leafminer, thuja mining moth or American thuja shoot moth, is a moth of the family Yponomeutidae. It is found in southeastern Canada and the northeastern United States to North Carolina, west to Missouri, north to Manitoba. There is also an isolated population in British Columbia. The species is also present in Europe,Fauna Europaea where it has been introduced on three occasions: to the Netherlands in 1971, Germany in 1975 and Austria in 1976. The wingspan is about 8 mm. Adults are on wing from May to July depending on the location. The larvae feed on the leaves of Thuja occidentalis as well as other arborvitae and false cypress (Chamaecyparis) species. Trees infested for several consecutive years can be killed, but usually an infested tree is able to renew foliage later during the growth season.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia thuiella has left across the world's sequence archives.

At a glance

DNA specimens56

BINs1

Marker genes1

eDNA detections52

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

278Tmostly conserved

477Gmostly conserved

499Gmostly conserved

AACATTATATTTTATCTTTGGAATTTGATCCGGAATAGTAGGAACATCATTAAGCTTATTAATTCGAGCAGAATTAGGAAACCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes6

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia arceuthinasame genus7.4%Argyresthia aurulentellasame genus8.1%Argyresthia trifasciatasame genus8.4%Argyresthia quadristrigellasame genus8.5%Argyresthia laricellasame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type518 records

Wild obs. + sensor401

Museum / vouchered97

Other20

Origin

Introduced3

Range

Area of Occupancy AOO1 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 263≤1 km 32≤10 km 11>10 km 32

338 georeferenced · 63 without coordinates

Open the mapobservation + sensor401

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 4≤1 km 33≤10 km 14>10 km 1

52 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	21
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Natural History Museum Rotterdamlocation not on record	7
Nijmegen, NL	6
Blacksburg, US	5
New Haven, US	4
Washington, US	4
Tilburg, NL	4
Provincia di Livornolocation not on record	3
Cornell University Insect Collectionlocation not on record	3
Philadelphia, US	2
SFRAlocation not on record	2
Cambridge, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Catholic University of Pekinglocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
DanishLepidopterologicalSocietylocation not on record	1

19 institutions · 78 of 97 vouchered records shown · 19 without an institution code

09Environmental DNA52 detections

Where the DNA of Argyresthia thuiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map4 countries0

farm1. Forest & Woodland14. Artificial - Terrestrial|14.5 Urban AreasUrbanMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 16.0–20.5

Seasonal swing summer↔winter27.2 °C

Max temp (day)23.7 °C 19.9–25.7

Min temp (night)13.4 °C 11.7–16.5

Precipitation83.2 mm/mo 81.0–92.8

Air humidity57.6 % 57.0–60.1

Moisture balance-58.4 mm/mo -68.0–-31.8

Vapour deficit888 Pa 704–1,016

Wind speed3.20 m/s 2.30–3.90

Cloud cover41.5 % 38.7–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)