Argyresthia glaucinella

Zeller, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records393

Data sources7

Biological traits2

DNA specimens17

eDNA detections22

Sources7 archives

Databases and archives Argyresthia glaucinella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility393 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF393 records

Environmental DNA3 datasets · 6 countries22 detections

DNA & barcodingBOLD17 specimens

01Narrative

Argyresthia glaucinella is a moth of the family Yponomeutidae. It is found in Europe.Fauna Europaea The wingspan is about 9 mm. The head is yellowish -white.Forewings are brassy-fuscous ; a whitish dorsal streak, strigulated with dark fuscous ; a thick median fascia and apical patch darker fuscous, with bluish reflections, separated by whitish irroration. Hindwings are grey.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Adults are on wing from June to July depending on the location. The larvae feed on Quercus, Aesculus hippocastanum and Betula.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia glaucinella has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections22

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

313Gmostly conserved

CACTCTATATTTTATTTTTGGAATTTGATCAGGAATATTAGGAACATCATTAAGATTATTAATTCGAGCAGAATTAGGTAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia aurulentellasame genus8.5%Argyresthia arceuthinasame genus8.7%Argyresthia quadristrigellasame genus8.7%Argyresthia sabinaesame genus9.4%Argyresthia annettellasame genus9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type393 records

Wild obs. + sensor300

Museum / vouchered90

Other3

Range

Area of Occupancy AOO920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 71≤1 km 75≤10 km 147

293 georeferenced · 7 without coordinates

Open the mapobservation + sensor300

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 38≤1 km 13≤10 km 3>10 km 1

55 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	21
Stockholm, SE	16
NHMOlocation not on record	14
DanishLepidopterologicalSocietylocation not on record	14
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	7
South Kensington, GB	5
Natural History Museum, Londonlocation not on record	5
BioFokuslocation not on record	1
Oulu, FI	1
ZSMlocation not on record	1

10 institutions · 85 of 90 vouchered records shown · 5 without an institution code

09Environmental DNA22 detections

Where the DNA of Argyresthia glaucinella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys3

Countries6

Verifiable raw sequence linked10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 10.6–18.9

Seasonal swing summer↔winter18.6 °C

Max temp (day)18.9 °C 14.8–23.3

Min temp (night)10.7 °C 5.50–14.2

Precipitation78.7 mm/mo 40.7–175

Air humidity59.5 % 58.4–62.8

Moisture balance-45.6 mm/mo -88.5–71.2

Vapour deficit685 Pa 450–916

Wind speed3.20 m/s 2.70–4.10

Cloud cover39.2 % 32.2–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)