Argyresthia fundella

Fischer von Röslerstamm, 1835 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records326

Data sources7

Biological traits0

DNA specimens17

eDNA detections18

Sources7 archives

Databases and archives Argyresthia fundella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility326 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF326 records

Environmental DNA2 datasets · 6 countries18 detections

DNA & barcodingBOLD17 specimens

01Narrative

Argyresthia fundella is a moth of the family Yponomeutidae. It is found in most of Europe, except Ireland, Great Britain, the Iberian Peninsula, Finland, the Baltic region, Slovenia, Hungary and Greece.Fauna Europaea The wingspan is 9–10 mm.microlepidoptera.nl The larvae feed on Abies alba, Abies balsamea, Abies concolor, Abies grandis, Abies nordmanniana and Abies numidica. They mine the leaves of their host plant. The mine is usually only found in the distal half of the leaf. Initially, the larva feeds towards the tip. It then descends along the other side of the leaf. Most frass is deposited in the leaf tip. A round hole is made at the base of the mine, which the larva uses to leave the mine. This hole is closed with silk. A single larva creates mines in several leaves before overwintering inside the mine. Pupation takes place outside of the mine at the underside of a leaf. The larvae have a dirty dark green body and a black head. They can be found from late summer to April.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia fundella has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections18

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

37Amostly conserved

43Tmostly conserved

55Tmostly conserved

58Amostly conserved

70Gvariable

88Amostly conserved

200Gmostly conserved

220Cmostly conserved

235Tmostly conserved

238Cmostly conserved

266Cmostly conserved

278Cvariable

289Amostly conserved

290Amostly conserved

334Amostly conserved

368Gmostly conserved

403Tvariable

412Tmostly conserved

424Tvariable

448Tmostly conserved

478Tmostly conserved

484Cmostly conserved

485Tmostly conserved

496Amostly conserved

506Gmostly conserved

559Gvariable

574Tmostly conserved

616Tmostly conserved

653Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGTACCTCTTTAAGTTTATTAATTCGAGCGGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes5

BIN1

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia aurulentellasame genus8.5%Argyresthia alternatellasame genus9.1%Argyresthia arceuthinasame genus9.6%Argyresthia trifasciatasame genus9.7%Argyresthia austerellasame genus9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type326 records

Wild obs. + sensor170

Museum / vouchered114

Other42

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 42≤1 km 49≤10 km 67>10 km 2

160 georeferenced · 10 without coordinates

Open the mapobservation + sensor170

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 37≤1 km 36≤10 km 7

80 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	33
NHMOlocation not on record	24
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	20
Provincia di Livornolocation not on record	12
Salzburg, AT	7
European Distributed Institute of Taxonomy (EDIT)location not on record	4
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	4
SLU Artdatabankenlocation not on record	2
ZSMlocation not on record	1

9 institutions · 107 of 114 vouchered records shown · 7 without an institution code

09Environmental DNA18 detections

Where the DNA of Argyresthia fundella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys2

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 9.40–15.5

Seasonal swing summer↔winter18.6 °C

Max temp (day)18.2 °C 13.2–19.5

Min temp (night)9.20 °C 4.50–11.3

Precipitation140 mm/mo 73.5–194

Air humidity61.4 % 58.1–64.6

Moisture balance10.4 mm/mo -54.0–125

Vapour deficit642 Pa 424–714

Wind speed3.10 m/s 1.90–4.30

Cloud cover40.0 % 35.5–46.8

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)