Argyresthia alternatella

Kearfott, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records364

Data sources7

Biological traits0

DNA specimens78

eDNA detections75

Sources7 archives

Databases and archives Argyresthia alternatella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility364 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI75 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF364 records

Environmental DNA1 datasets · 2 countries75 detections

DNA & barcodingBOLD78 specimens

01Narrative

Argyresthia alternatella is a moth of the family Yponomeutidae. It is found in North America, including Arkansas, Kentucky, Maryland, Massachusetts, Mississippi, New Jersey, Ohio, Oklahoma, Ontario, Quebec and Texas. The wingspan is 10–12 mm. The forewings are golden-ochreous. There are five brown spots on the costa and three similar spots on the dorsal margin. There is also a streak of brown on the dorsum at the base and the apex of the wing is lightly reticulated with this colour. The hindwings are light fuscous.The biology of the juniper berry insects, with descriptions of new species The larvae feed on Juniperus species.HOSTS - a Database of the World's Lepidopteran Hostplants Young larvae bore into the seed of their host plant while the seed-coat is still soft. They consume many of the seeds. Full-grown larvae feed on the fleshy portion of the berries. Pupation usually takes place outside of the berry in a white, silken cocoon.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia alternatella has left across the world's sequence archives.

At a glance

DNA specimens78

BINs1

Marker genes1

eDNA detections75

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus75 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

34Gmostly conserved

95Amostly conserved

101Gmostly conserved

347Cmostly conserved

367Tmostly conserved

368Gvariable

400Gmostly conserved

403Gvariable

506Gmostly conserved

557Tvariable

AACATTATATTTTATTTTTGGAATTTGATCTGGGATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes10

BIN1

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia reticulatasame genus7.8%Argyresthia aurulentellasame genus7.9%Argyresthia amiantellasame genus8.2%Argyresthia arceuthinasame genus8.2%Argyresthia sabinaesame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type364 records

Wild obs. + sensor242

Museum / vouchered122

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 134≤1 km 44≤10 km 9>10 km 8

195 georeferenced · 47 without coordinates

Open the mapobservation + sensor242

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence122

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	29
University of Guelph, Centre for Biodiversity Genomicslocation not on record	24
Washington, US	15
Cornell University Insect Collectionlocation not on record	9
North Carolina State University Insect Museumlocation not on record	7
Centre for Biodiversity Genomicslocation not on record	1

6 institutions · 85 of 122 vouchered records shown · 37 without an institution code

09Environmental DNA75 detections

Where the DNA of Argyresthia alternatella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found75

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 75 detections have coordinates

Open the map2 countries0

WetlandGrassland4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 11.7–18.4

Seasonal swing summer↔winter25.6 °C

Max temp (day)18.0 °C 18.0–24.2

Min temp (night)5.80 °C 5.80–12.5

Precipitation59.9 mm/mo 14.4–92.4

Air humidity55.8 % 45.4–56.6

Moisture balance-63.5 mm/mo -150–-46.4

Vapour deficit632 Pa 608–1,084

Wind speed2.10 m/s 1.90–3.30

Cloud cover36.8 % 25.2–47.4

CHELSA 1981–2010, ~9 km grid, at location & month of 72 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)