Argyresthia flexilis

Freeman, 1961 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records14

Data sources7

Biological traits0

DNA specimens91

eDNA detections91

Sources7 archives

Databases and archives Argyresthia flexilis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI91 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics91 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 2 countries91 detections

DNA & barcodingBOLD91 specimens

01Narrative

Argyresthia flexilis is a moth of the family Yponomeutidae first described by Hugh Avery Freeman in 1960.mothphotographersgroup It is found in the United States in northern Montana and probably the adjacent parts of Canada. The wingspan is about 11 mm. The forewings are yellowish white and the hindwings are smoky. Adults are on wing in late June. The larvae feed on Pinus flexilis.HOSTS - a Database of the World's Lepidopteran Hostplants Late instar larvae tie needles into a bundle and mine two or more of them, starting below the middle of the needle, and mining toward the apex. The frass is ejected through the mine entrance. Full-grown larvae construct a new bundle within which pupation takes place in a dense, white cocoon.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding91 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia flexilis has left across the world's sequence archives.

At a glance

DNA specimens91

BINs1

Marker genes1

eDNA detections91

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus88 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

334Amostly conserved

400Gmostly conserved

529Gmostly conserved

ACTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACATCATTAAGTTTACTAATTCGTGCAGAATTAGGTAATCCCGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes13

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia arceuthinasame genus9.0%Argyresthia alternatellasame genus9.3%Argyresthia aurulentellasame genus9.3%Argyresthia sabinaesame genus9.6%Argyresthia calliphanessame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type14 records

Wild obs. + sensor2

Museum / vouchered12

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Washington, US	4

2 institutions · 9 of 12 vouchered records shown · 3 without an institution code

09Environmental DNA91 detections

Where the DNA of Argyresthia flexilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found91

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 91 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest4. Native GrasslandGrassland4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 14.9–18.1

Seasonal swing summer↔winter25.5 °C

Max temp (day)25.7 °C 21.8–25.7

Min temp (night)10.0 °C 7.90–11.2

Precipitation39.3 mm/mo 35.4–57.9

Air humidity45.0 % 45.0–51.8

Moisture balance-122 mm/mo -122–-86.6

Vapour deficit1,161 Pa 822–1,161

Wind speed2.80 m/s 2.10–2.80

Cloud cover29.5 % 29.5–33.8

CHELSA 1981–2010, ~9 km grid, at location & month of 91 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)