Argyresthia calliphanes

Meyrick, 1913 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records897

Data sources7

Biological traits0

DNA specimens10

eDNA detections4

Sources7 archives

Databases and archives Argyresthia calliphanes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility897 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF897 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD10 specimens

01Narrative

Argyresthia calliphanes is a moth of the family Yponomeutidae first described by Edward Meyrick in 1913.mothphotographersgroup It is found in Canada from Ontario to British Columbia and possibly in Alberta, Saskatchewan and Manitoba. In the United States, it ranges from New York to California. The wingspan is 13–14 mm. The forewings are shining snow white with shining golden markings, partially edged with coppery. The hindwings are grey, but darker posteriorly. Adults are on wing from June to August. The larvae feed on Alnus species.HOSTS - a Database of the World's Lepidopteran Hostplants

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia calliphanes has left across the world's sequence archives.

At a glance

DNA specimens10

BINs3

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

1Cvariable

38Gmostly conserved

58Avariable

59Cvariable

100Amostly conserved

101Gmostly conserved

214Amostly conserved

232Tmostly conserved

271Cmostly conserved

274Cmostly conserved

286Avariable

287Cvariable

322Amostly conserved

400Amostly conserved

403Avariable

451Cvariable

487Tvariable

496Gvariable

526Tvariable

530Gvariable

541Avariable

562Gvariable

574Tvariable

625Amostly conserved

628Avariable

CACATTATATTTTATTTTTGGAATTTGATCTGGTATAGTGGGAACATCTTTAAGATTACTAATTCGAGCAGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes3

BINs3

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia goedartellasame genus3.4%Argyresthia bonnetellasame genus7.3%Argyresthia conjugellasame genus7.4%Argyresthia brockeellasame genus7.6%Argyresthia pulchellasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type897 records

Wild obs. + sensor857

Museum / vouchered40

Range

Area of Occupancy AOO1 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 561≤1 km 98≤10 km 13>10 km 56

728 georeferenced · 129 without coordinates

Open the mapobservation + sensor857

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 5≤10 km 3

9 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	24
East Lansing, US	5
New Haven, US	3
Cornell University Insect Collectionlocation not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
San Francisco, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
St. Paul, US	1

8 institutions · 40 of 40 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Argyresthia calliphanes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 17.2–21.1

Seasonal swing summer↔winter28.4 °C

Max temp (day)22.2 °C 18.9–25.4

Min temp (night)16.4 °C 15.9–16.8

Precipitation85.0 mm/mo 76.5–93.4

Air humidity60.9 % 59.1–62.6

Moisture balance-76.7 mm/mo -84.2–-69.1

Vapour deficit887 Pa 744–1,031

Wind speed4.20 m/s 3.50–5.00

Cloud cover40.4 % 39.6–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)