Argyresthia bonnetella

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records2 524

Data sources7

Biological traits2

DNA specimens52

eDNA detections85

Sources7 archives

Databases and archives Argyresthia bonnetella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 524 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI85 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 524 records

Environmental DNA3 datasets · 11 countries85 detections

DNA & barcodingBOLD52 specimens

01Narrative

Argyresthia bonnetella is a moth of the family Yponomeutidae. It is found in Europe. The wingspan is 9–11 mm.The head is white. Forewings are shining ochreous-whitish, usually strigulated and sometimes discally suffused with ferruginous brown; a suffused ferruginous -brown median longitudinal streak from base to before middle ; a curved dark ferruginous- brown fascia from middle of dorsum to 4/5 of costa, sometimes obsolete except on dorsum. Hindwings are grey. The larva is yellow-green ; head and plate of 2 brown.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from July to September. . The larvae feed on Crataegus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia bonnetella has left across the world's sequence archives.

At a glance

DNA specimens52

BINs1

Marker genes1

eDNA detections85

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

184Gmostly conserved

427Tmostly conserved

565Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGTATAGTAGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes3

BIN1

Most divergent pair0.46%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia pruniellasame genus3.6%Argyresthia submontanasame genus3.8%Argyresthia sorbiellasame genus3.8%Argyresthia curvellasame genus4.6%Argyresthia oreasellasame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 524 records

Wild obs. + sensor1 907

Museum / vouchered528

Other89

Origin

Native5

Range

Area of Occupancy AOO4 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 649≤1 km 381≤10 km 782

1 812 georeferenced · 95 without coordinates

Open the mapobservation + sensor1 907

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 240≤1 km 35≤10 km 36>10 km 13

324 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence528

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	206
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	128
SLU Artdatabankenlocation not on record	48
Stockholm, SE	27
Oulu, FI	27
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	16
Tartu, EE	13
NHMOlocation not on record	13
Natural History Museum Rotterdamlocation not on record	6
Salzburg, AT	5
Natural History Museum, Londonlocation not on record	5
South Kensington, GB	5
European Distributed Institute of Taxonomy (EDIT)location not on record	2
ZSMlocation not on record	2
Naturalis Biodiversity Centerlocation not on record	2
Provincia di Livornolocation not on record	2
Kuopio, FI	1
University of Kaiserslauternlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

19 institutions · 510 of 528 vouchered records shown · 18 without an institution code

09Environmental DNA85 detections

Where the DNA of Argyresthia bonnetella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found85

Studies independent surveys3

Countries11

Verifiable raw sequence linked37

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 85 detections have coordinates

Open the map11 countries0

1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 12.6–18.8

Seasonal swing summer↔winter18.4 °C

Max temp (day)20.8 °C 15.9–23.2

Min temp (night)13.8 °C 10.0–14.8

Precipitation59.3 mm/mo 54.7–97.0

Air humidity60.7 % 58.0–62.8

Moisture balance-48.3 mm/mo -83.1–-0.6

Vapour deficit760 Pa 556–903

Wind speed3.20 m/s 2.60–4.20

Cloud cover40.5 % 33.3–45.2

CHELSA 1981–2010, ~9 km grid, at location & month of 83 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia bonnetella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 524 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 524 records