Argyresthia sorbiella

Treitschke, 1835 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records3 029

Data sources9

Biological traits2

DNA specimens34

eDNA detections109

Sources9 archives

Databases and archives Argyresthia sorbiella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 029 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI109 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 029 records

Environmental DNA3 datasets · 8 countries109 detections

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT · NCBI≈645 Mbp

01Narrative

Argyresthia sorbiella is a moth of the family Yponomeutidae. It is found in Northern Europe and Central Europe.Fauna Europaea The wingspan is .The head and thorax are whitish. Forewings are shining whitish, on costal half strigulated with light golden-brown ; a transverse dorsal mark at 1/3, an outwardly oblique streak from middle of dorsum, and an indistinct tornal mark golden-brown. Hindwings are grey.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from May to August. The larvae feed on Sorbus aucuparia and Sorbus aria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia sorbiella has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections109

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

334Amostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGTATAGTAGGAACATCCTTAAGATTATTAATTCGAGCGGAATTAGGTAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.03%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia pruniellasame genus3.3%Argyresthia bonnetellasame genus3.8%Argyresthia pulchellasame genus4.9%Argyresthia curvellasame genus5.0%Argyresthia pygmaeellasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Argyresthia sorbiella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈644 501 902 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Argyresthia sorbiella0.64 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.2% BUSCO

08Occurrence & distribution

Record type3 029 records

Wild obs. + sensor2 366

Museum / vouchered553

Other110

Range

Area of Occupancy AOO5 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 940≤1 km 595≤10 km 704>10 km 2

2 241 georeferenced · 125 without coordinates

Open the mapobservation + sensor2 366

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 245≤1 km 189≤10 km 64>10 km 21

519 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence553

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	100
Oulu, FI	73
SLU Artdatabankenlocation not on record	38
Provincia di Livornolocation not on record	31
RMZlocation not on record	28
Tartu, EE	23
Rovaniemi, FI	16
DanishLepidopterologicalSocietylocation not on record	15
Kuopio, FI	13
European Distributed Institute of Taxonomy (EDIT)location not on record	11
DABUHlocation not on record	11
Stockholm, SE	8
Tromsø, NO	6
Salzburg, AT	4
Metsähallituslocation not on record	4
NTNU-VMlocation not on record	3
Tallinn, EE	2
ZSMlocation not on record	1
South Kensington, GB	1
ZMAAlocation not on record	1
neflocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1
Tilburg, NL	1

23 institutions · 392 of 553 vouchered records shown · 161 without an institution code

09Environmental DNA109 detections

Where the DNA of Argyresthia sorbiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found109

Studies independent surveys3

Countries8

Verifiable raw sequence linked68

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 109 detections have coordinates

Open the map8 countries0

Hay meadowFarmland, coast and birch habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 11.2–16.4

Seasonal swing summer↔winter21.1 °C

Max temp (day)17.6 °C 14.1–20.3

Min temp (night)10.6 °C 5.70–12.9

Precipitation99.9 mm/mo 62.4–150

Air humidity60.2 % 58.4–63.8

Moisture balance-13.5 mm/mo -51.8–62.9

Vapour deficit649 Pa 490–776

Wind speed2.80 m/s 2.10–3.90

Cloud cover51.2 % 37.1–54.5

CHELSA 1981–2010, ~9 km grid, at location & month of 106 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia sorbiella

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 029 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 029 records