Argyresthia oreasella

Clemens, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records1 797

Data sources6

Biological traits0

DNA specimens220

eDNA detections260

Sources6 archives

Databases and archives Argyresthia oreasella's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 797 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI260 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics220 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 797 records

Environmental DNA1 datasets · 2 countries260 detections

DNA & barcodingBOLD220 specimens

01Narrative

Argyresthia oreasella, the cherry shoot borer moth, is a moth of the family Yponomeutidae. It is found in North America, including New York, Michigan, Idaho, Missouri, Colorado, New Mexico, California, Quebec, Alberta and Saskatchewan. The wingspan is 10–13 mm. The forewings are silvery white, with a pale golden brown streak at the base of the costa. The hindwings are dark gray. Adults are on wing from the end of June to mid August. The larvae feed on Prunus virginiana, Prunus pensylvanica, Amelanchier alnifolia and possibly Quercus species. They mine the shoots of their host plant. Larvae leave the stem to pupate. Full-grown larvae are light green and reach a length of 7 mm. This species overwinters as an egg on leaf buds.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding220 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia oreasella has left across the world's sequence archives.

At a glance

DNA specimens220

BINs1

Marker genes1

eDNA detections260

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus170 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

100Amostly conserved

AACATTATACTTTATTTTTGGAATTTGATCTGGTATAGTAGGAACATCATTAAGATTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.77%

Haplotypes7

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia spinosellasame genus3.5%Argyresthia curvellasame genus4.1%Argyresthia pygmaeellasame genus4.1%Argyresthia bonnetellasame genus4.6%Argyresthia pruniellasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 797 records

Wild obs. + sensor1 338

Museum / vouchered459

Range

Area of Occupancy AOO3 264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 725≤1 km 267≤10 km 39>10 km 90

1 121 georeferenced · 217 without coordinates

Open the mapobservation + sensor1 338

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 11≤1 km 16≤10 km 11>10 km 7

45 georeferenced · 414 without coordinates

Open the institutions mapphysical evidence459

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	95
University of Alberta Museums (UAM)location not on record	87
North Carolina State University Insect Museumlocation not on record	29
Cornell University Insect Collectionlocation not on record	27
East Lansing, US	25
Washington, US	19
Mississippi State, US	15
Royal Saskatchewan Museumlocation not on record	9
San Francisco, US	7
University of California, Davislocation not on record	6
Edmonton, CA	4
St. Paul, US	3
New Haven, US	2
Cambridge, US	1
Decorah, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
SOVTlocation not on record	1

18 institutions · 333 of 459 vouchered records shown · 126 without an institution code

09Environmental DNA260 detections

Where the DNA of Argyresthia oreasella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found260

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 260 detections have coordinates

Open the map2 countries0

Grassland4. Native GrasslandMixed habitat1. Forest & Woodland|1.1 Boreal Forest1. Forest & WoodlandMeadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 15.5–20.2

Seasonal swing summer↔winter24.3 °C

Max temp (day)21.5 °C 19.4–24.7

Min temp (night)11.4 °C 10.1–16.9

Precipitation73.2 mm/mo 42.3–104

Air humidity57.0 % 52.8–62.6

Moisture balance-63.6 mm/mo -84.3–-1.20

Vapour deficit791 Pa 680–989

Wind speed2.40 m/s 1.40–5.30

Cloud cover40.9 % 33.4–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 259 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia oreasella

At a glance

Sources6 archives

At a glance

Record type1 797 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 797 records